Effects of Lin28a overexpression on gene expression changes during culturing neural stem cells (NSCs) derived from mouse embryonic ventral midbrain (VM)
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Jin-Wu Nam
PROVIDER: E-GEOD-77851 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Precise spatiotemporal control of mRNA translation machinery is essential to proper development of highly complex systems like the neocortex. Here, we show that an RNA-binding protein, Hu antigen R (HuR), regulates both neocorticogenesis and specificity of neocortical translation machinery in a developmental stagedependent manner in mice. Neocortical absence of HuR alters the phosphorylation states of the initiation and elongation factors of the core translation machinery. In addition, HuR regulates the temporally specific positioning of functionally related mRNAs into the active translation sites, the polysomes. HuR also determines the specificity of neocortical polysomes by defining their combinatorial composition of ribosomal proteins and initiation and elongation factors. For some of the HuR-dependent proteins, the association with polysomes depends on the eIF2 alpha kinase 4 (eIF2ak4), which associated with HuR in prenatal developing neocortices. Finally, we found that deletion of HuR prior to embryonic day 10 (E10) disrupts both neocortical lamination and formation of the main neocortical commissure, the corpus callosum. Our study identifies a crucial role for HuR in neocortical development as a translational gatekeeper for functionally related mRNA subgroups and polysomal protein specificity. Cortex was dissected from mouse pups at embryonic day 13 (E13) or the day of birth (P0).
2014-08-25 | E-GEOD-50809 | biostudies-arrayexpress
Project description:The gene expression of Trypanosoma brucei has been examined extensively in the blood of mammalian hosts and in forms found in the midgut of its arthropod vector, the tsetse fly. However, trypanosomes also undergo development within the mammalian bloodstream as they progress from morphologically M-bM-^@M-^Xslender formsM-bM-^@M-^Y to transmissible M-bM-^@M-^Xstumpy formsM-bM-^@M-^Y through morphological intermediates. This transition is temporally progressive within the first wave of parasitaemia such that gene expression can be monitored in relatively pure slender and stumpy populations as well as during the progression between these extremes. The development also represents the progression of cells from translationally active forms adapted for proliferation in the host to translationally quiescent forms, adapted for transmission. We have used metabolic labelling to quantitate translational activity in slender forms, stumpy forms and in forms undergoing early differentiation to procyclic forms in vitro. Thereafter we have examined the cohort of total mRNAs that are enriched in throughout development in the mammalian bloodstream (slender, intermediate and stumpy forms), irrespective of strain, revealing those that exhibit consistent developmental regulation rather than sample specific changes. Transcripts that cosediment with polysomes in stumpy forms and slender forms have also been identified to enrich transcripts that escape translational repression prior to transmission. Combined, the expression and polysomal association of transcripts as trypanosomes undergo development in the mammalian bloodstream haves been defined, providing a resource for trypanosome researchers. This facilitates the identification of those that undergo developmental regulation in the bloodstream and therefore those likely to have a role in the survival and capacity for transmission of stumpy forms. Examination of gene expression during life cycle stages.
2013-12-16 | E-GEOD-46388 | biostudies-arrayexpress
Project description:OASL1 is a novel translation inhibitor for the type I IFN master transcription factor IRF7. To examine whether OASL1 specifically inhibit IRF7 translation, we used a genome-wide gene expression microarray to screen for the polysome-associated mRNAs more enriched in the OASL1 KO BMDMs. The microarray analysis on the polysomal fractions identified 145 candidate transcripts, including IRF7, that showed a signal greater than two-fold higher in poly(I:C)-treated Oasl1-/- BMDM. We analyzed polysomal fractions from poly(I:C)-treated WT and Oasl1-/- BMDM using the Affymetrix Mouse Gene 1.0 ST array. Array data were processed by Affymetrix GCOS software. We compared these using Affymetrix Expression console1.1, R affy-package(2.9.2), DAVID.
2013-02-17 | E-GEOD-41787 | biostudies-arrayexpress
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:The sequence of gene regulatory events that drive neonatal germ cell development in the mammalian testis is not yet clear. We assessed changes in mRNA utilization in the neonatal testis at 1 and 4 dpp, times when the testis contains quiescent gonocytes (1 dpp) and proliferating spermatogonia (4 dpp). There are not thought to be major changes in the nature or number of somatic cells over that interval. We used microarrays to detail the global expression levels of mRNA distribution between non-translating mRNAs and efficiently translating mRNAs during testis development at 1 dpp and 4 dpp Extracts of mouse testes from 1 dpp and 4 dpp CD-1 mice were fractionated over a sucrose gradient in triplicate. Gradients were fractionated using an ISCO gradient fractionation system equipped with a UA-6 detector. The position of the 80S peak defined the boundary between translating and non-translating mRNAs. Pooled non-polysomal (non-translating; fractions 1-3) and heavy polysomal (efficiently translating, fractions 7-13) RNAs were isolated from sucrose gradient fractions for hybridization on Affymetrix 420 2.0 microarrays.
2013-07-27 | E-GEOD-49283 | biostudies-arrayexpress
Project description:Differentiation of mesenchymal stem cells into adipocytes was studied. Control (undifferentiated) stem cells were compared to induced (3 days of induction) cells. In addition, two RNA fractions are studied: RNA associated to polysomes and total RNA.
2013-07-10 | E-MTAB-1366 | biostudies-arrayexpress
Project description:The following data contains sequencing files for RNA IP and Polysome profiling experiments in wt and not5delta strains with background of Not1-TAP tagged strain (MAT_ leu2_20 ura3_ met15_ lys2_ his3delta1 not1::NOT1-Tap-tag-URA3). The RNA IP experiments have been performed as described previously (Gupta et al 2014) and the Polysome profiling experiments have been performed as described in (Albanese 2010). The libraries have been sequenced using polyadenylation isoform specific profiling protocol. The Not1 RIP experiments demonstrate genome-wide association of RNA with the central essential scaffold of the Ccr4-Not complex. The same RIP experiment in the not5delta background demonstrates the specificity of not5 in determining Not1 binding specificity to pulled down RNA. The polysome profiling experiments demonstrate the role of not5 in determining the translatability of ribosomal RNA.
2015-12-19 | E-MTAB-3195 | biostudies-arrayexpress
Project description:Poly-ribosomal mRNA from pools of 75 bovine oocytes at the germinal vesicle(GV) and metaphase II(MII) stages were isolated by sucrose fractionation then compared through microarray hybridization. 3 biological replicates from germinal vesicle(GV) and metaphase II(MII) bovine oocytes were hybridized against each other while alternating dyes. One additional technical replicate (dye-swap of one of the previous hybridizations) was added to balance dye usage. The normalized log2 ratio (GV/MII) data is provided in the 'normalized_data.txt' file. Please note that data were scanned/extracted using a different Agilent reference file, and thus the feature extraction number for a given probe (in both normalized and raw data files) is different from that in the official Agilent-041017 platform (GPL18537). The reference file used for this study is provided as a Series supplementary file (041017_D_DNAFront_BCBottom_20120517.txt).
2014-09-09 | E-GEOD-56603 | biostudies-arrayexpress
Project description:In obesity, adipose tissue expands by increasing the volume of existing adipocytes (hypertrophy), increasing the number of small adipocytes (hyperplasia) or both. Much is known about transcriptional control during adipogenesis, including early events. However, translational control plays a pivotal role in many dynamic processes and we presume that it is also important for the control of adipogenesis, especially in the first hours after hormonal induction. By use of ribosome profiling we identified 43 genes that are up-regulated and 2 genes that are down-regulated during the first six hours of adipogenesis in 3T3-L1 cells. Interestingly, we found Ghrelin to be down-regulated. Up-regulated genes comprise factors that are nucleic acid binding (Cdkn1c, eIF4b, Hsf1, Irf6, Myc, Plekhn1, Polr2a, Rpl18, Rpl27a, Rpl6, Rpl7a, Rps18, Rpsa, Sema3g, Tbc1d22a, Tsc22d3), form part of ribosomes (L6, L7a, L18, L27a, Sa, S18, S15a pseudogene), act on the regulation of translation (eIF4b) or transcription (Hsf1, Irf6, Myc, Tsc22d3). Others act as chaperones (Bag3, Hspa8/Hsc70, Hsp90ab1) or in other metabolic or signals transducing processes. We conclude that a moderate reorganisation of the functionality of the ribosomal machinery is a very important step for the growth and expression control at the beginning of adipogenesis. 12 samples: 4 (0h, non-polysomal fraction; 0h, polysomal fraction; 6h, non-polysomal fraction; 6h, polysomal fraction) x3 replicates
2012-03-28 | E-GEOD-29744 | biostudies-arrayexpress
Project description:DDX6 is an abundant cytoplasmic DEAD-box RNA helicase which is involved in disparate aspects of mRNA stability and translation, leading to a confused understanding of its global function. We carried out a large-scale study of total and polysomial mRNA after DDX6 depletion to get an accurate picture of its roles in human cells.
2017-09-28 | E-MTAB-4091 | biostudies-arrayexpress