Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

Transcription profiling of C. elegans embryonic muscle

ABSTRACT: Background: The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of Caenorhabditis elegans Cells (MAPCeL) to muscle cell populations extracted from developing Caenorhabditis elegans embryos. Results: Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early Caenorhabditis elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,305 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: This study provides a comprehensive description of gene expression in developing Caenorhabditis elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in Caenorhabditis elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Experiment Overall Design: Our goal is to profile gene expression in the major excitable tissues of Caenorhabditis elegans. As part of this effort, we profiled embryonic muscle cells at two timepoints: 0hr and 24hr.. To isolate transcripts from these cells we utilized the MAPCeL (Microarray Profiling Caenorhabditis elegans Cells) technique, which our lab previously developed (Fox et al 2005) in which myo-3::GFP+ cells are captured by FACS for RNA isolation. We verified these data by bioinformatic means and by in vivo validation by creating GFP reporters for a random set of genes in our enriched gene list.

ORGANISM(S): Caenorhabditis elegans

SUBMITTER: David Miller

PROVIDER: E-GEOD-8462 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Publications

The embryonic muscle transcriptome of Caenorhabditis elegans.

Fox Rebecca M RM Watson Joseph D JD Von Stetina Stephen E SE McDermott Joan J Brodigan Thomas M TM Fukushige Tetsunari T Krause Michael M Miller David M DM

Genome biology 20070101 9

<h4>Background</h4>The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also found in animals with more complex body ...[more]

PMID: 17848203

Similar Datasets

Project description:Background: Differential gene expression specifies the highly diverse cell types that constitute the nervous system. With its sequenced genome and simple, well-defined neuroanatomy, the nematode C. elegans is a useful model system in which to correlate gene expression with neuron identity. The UNC-4 transcription factor is expressed in thirteen embryonic motor neurons where it specifies axonal morphology and synaptic function. These cells can be marked with an unc-4::GFP reporter transgene. Here we describe a powerful strategy, Micro-Array Profiling of C. elegans cells (MAPCeL), and confirm that this approach provides a comprehensive gene expression profile of unc-4::GFP motor neurons in vivo. Results: Fluorescence Activated Cell Sorting (FACS) was used to isolate unc-4::GFP neurons from primary cultures of C. elegans embryonic cells. Microarray experiments detected 6,217 unique transcripts of which ~1,000 are enriched in unc-4::GFP neurons relative to the average nematode embryonic cell. The reliability of these data was validated by the detection of known cell-specific transcripts and by expression in UNC-4 motor neurons of GFP reporters derived from the enriched data set. In addition to genes involved in neurotransmitter packaging and release, the microarray data include transcripts for receptors to a remarkably wide variety of signaling molecules. The added presence of a robust array of G-protein pathway components is indicative of complex and highly integrated mechanisms for modulating motor neuron activity. Over half of the enriched genes (537) have human homologs, a finding that could reflect substantial overlap with the gene expression repertoire of mammalian motor neurons. Conclusion: We have described a microarray-based method, MAPCeL, for profiling gene expression in specific C. elegans motor neurons and provide evidence that this approach can reveal candidate genes for key roles in the differentiation and function of these cells. These methods can now be applied to generate a gene expression map of the C. elegans nervous system. Experiment Overall Design: Our goal is to profile gene expression throughout the nervous system of the model organism Caenorhabditis elegans. As a first goal, we profiled a single class of embryonic motor neurons. To isolate transcripts from thesec neurons we developed the MAPCeL (Microarray Profiling C. elegans Cells) technique in which unc-4::GFP+ cells are captured by FACS for RNA isolation. We verified these data by bioinformatic means and by in vivo validation by creating GFP reporters for a random set of genes in our enriched gene list.

Project description:Background: ; The force generating mechanism of muscle is evolutionarily ancient; the fundamental structural and functional components of the sarcomere are common to motile animals throughout phylogeny. Recent evidence suggests that the transcription factors that regulate muscle development are also conserved. Thus, a comprehensive description of muscle gene expression in a simple model organism should define a basic muscle transcriptome that is also expressed in animals with more complex body plans. To this end, we have applied Micro-Array Profiling of C. elegans (MAPCeL) to muscle cell populations extracted from developing C. elegans embryos. Results: ; Fluorescence Activated Cell Sorting (FACS) was used to isolate myo-3::GFP-positive muscle cells, and their cultured derivatives, from dissociated early C. elegans embryos. Microarray analysis identified 6,693 expressed genes, 1,324 of which are enriched in the myo-3::GFP positive cell population relative to the average embryonic cell. The muscle-enriched gene set was validated by comparisons to known muscle markers, independently derived expression data, and GFP reporters in transgenic strains. These results confirm the utility of MAPCeL for cell type-specific expression profiling and reveal that 60% of these transcripts have human homologs. Conclusions: ; This study provides a comprehensive description of gene expression in developing C. elegans embryonic muscle cells. The finding that over half of these muscle-enriched transcripts encode proteins with human homologs suggests that mutant analysis of these genes in C. elegans could reveal evolutionarily conserved models of muscle gene function with ready application to human muscle pathologies. Experiment Overall Design: Approximately 80 one- and two-cell stage embryos were collected from either heat-shock hlh-1 (KM267) or heat-shock pal-1(JA1179) worms and were incubated for 20 min (hs pal-1) or 60 min (hs hlh-1) at room temperature prior to a heat pulse at 34oC for 30min. After the heat pulse, embryos were incubated at room temperature for 2, 4, and 6 hours (hs hlh-1) or 2, 4, 6, and 8 hours (hs pal-1) prior to total RNA isolation. Embryos were also collected prior to heat shock as a control (0 hour). Triplicate independent samples were prepared for all time points. All hs pal-1 experiments were performed on embryos derived from skn-1, pop-1 double RNAi injected animals. The isolation of total RNA from embryos followed the procedures in (Baugh et al. 2003). Total RNA was used with the Super Smart PCR cDNA synthesis kit (BD Clontech) in 20 cycles with a modified primer (SMART7T27 Primer: 5'-TGAAGCAGTGGTAACAACGCAGAGTAATACGACTCACTATAGGGAGAAGC(T)27VN -3') prior to one cycle target labeling reaction by standard procedures (Affymetrix). Affymetrix C. elegans gene chips (P/N900383, ~22,500 transcript probes) were processed according to manufactures protocol using the NIDDK Genomics Core Laboratory. Microarray data was normalized by MAS5 prior to analysis using GeneSpring software (Silicon Genetics).

Dataset Information

Transcription profiling of C. elegans embryonic muscle

Publications

The embryonic muscle transcriptome of Caenorhabditis elegans.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure