Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

9 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Design, characterization, and use of a novel amyloid Î²-protein control for assembly, neurotoxicity, and gene expression studies

ABSTRACT: A key pathogenic agent in Alzheimerâs disease (AD) is the amyloid Î²-protein (AÎ²), which self-assembles into a variety of neurotoxic structures. Establishing structure-activity relationships for these assemblies is critical for proper therapeutic target identification and design. We examined the effects of AÎ² monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. As opposed to âreverseâ AÎ² or non-AÎ² peptides typically used as controls in such studies, we designed novel scrambled AÎ² peptides predicted to behave distinctly from native AÎ². Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Weighted gene co-expression network analysis (WGCNA) revealed two predominant gene modules related to AÎ² treatment. Many genes within these modules were associated with inflammatory signaling pathways We examined the effects of AÎ² monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. Novel scrambled AÎ² peptides, as opposed to âreverseâ AÎ² or non-AÎ² peptides, were used as controls. Please note that the 'XL42_1' sample was excluded from data processing as an outlier (resulting total 23 sample records). However the 'XL42_1' raw data is provided in the 'non_normalized.txt' (total 24 data columns).

ORGANISM(S): Rattus norvegicus

SUBMITTER: Giovanni Coppola

PROVIDER: E-GEOD-85952 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Design, characterization, and use of a novel amyloid β-protein control for assembly, neurotoxicity, and gene expression studies

Project description:A key pathogenic agent in Alzheimer’s disease (AD) is the amyloid β-protein (Aβ), which self-assembles into a variety of neurotoxic structures. Establishing structure-activity relationships for these assemblies is critical for proper therapeutic target identification and design. We examined the effects of Aβ monomers, dimers, higher-order oligomers, and fibrils on gene expression in primary rat hippocampal neurons. As opposed to “reverse” Aβ or non-Aβ peptides typically used as controls in such studies, we designed novel scrambled Aβ peptides predicted to behave distinctly from native Aβ. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Significant changes in gene expression were observed for all peptide assemblies, but fibrils induced the largest changes. Weighted gene co-expression network analysis (WGCNA) revealed two predominant gene modules related to Aβ treatment. Many genes within these modules were associated with inflammatory signaling pathways

2016-08-24 | GSE85952 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Brain proteome analysis of APPswe mouse model at the early stages of Alzheimer's disease pathology

Project description:Plaques consisting of amyloid-Î² (AÎ²) in the brain are characteristic for patients with AlzheimerÂ´s disease. AÎ² is enzymatically generated of the amyloid precursor protein (APP). During the disease, AÎ² starts to aggregate forming soluble oligomers, soluble protofibrils and eventually insoluble fibrils. AÎ² pathology starts mainly at the hippocampus and the surrounding cortical area. Mice overexpressing the Aï�¢-precursor protein with the Swedish mutation (APPswe) are one of the most commonly used animal models in Alzheimerâ€™s field. These mice overexpress APP with the Swedish mutation (KM670/671NL), which is adjacent to the Î²-secretase cleavage site on APP. This results in increased production of AÎ². The aim of this study was to study the proteome of APPswe brain at the early stages (7-8 months old) of the disease, before plaque onset, which starts at around 11-12 months of age in this mouse model. Homogenates of the hippocampus and the rest of the cerebrum from 7-8 months-old APPswe and wild-type (WT) controls were lysed. Afterwards, filter aided tryptic digestion was performed. The resulting peptides were analyzed using LC-UDMSE. The data was searched against a randomized mouse database and label-free quantification analysis was done. In total 2487 proteins were found. In the hippocampus of APPswe mice, the levels of 1283 proteins were significantly altered compared to WT controls. While 1379 proteins were significantly altered in the rest of the cerebrum of APPswe mice compared to WT controls. Among these, mitochondrial proteins and proteins involved in neuron's development were significantly downregulated, suggesting mitochondrial dysfunction and dysregulation of neuronâ€™s growth in the brain of APPswe mice at already this stage of the disease.

2021-06-28 | PXD026566 | Pride

Receptor quaternary organization explains G protein-coupled receptor family structure.

Project description:Purpose: To investigate the quaternary structures of Rhodopsin-family GPCRs. Method: Analyzed 60 receptors from HEK 293T cells. Results: 1) Most of these receptors are monomers. 2) The phylogenetic distribution of dimers suggests that monomers have an evolutionary advantage due to constraints imposed by dimerization on rates of receptor diversification.

2017-08-10 | GSE102461 | GEO

p53 dimers elicit unique tumor suppressive activities through an altered metabolic program [RNA-seq]

Project description:Cancer-related alterations of the p53 Tetramerization Domain (TD) abrogate wild-type (WT) p53 function. They result in a protein that preferentially forms monomers or dimers. These are also normal p53 states under basal cellular conditions. However, their physiological relevance is not well understood. We have established in vivo models for monomeric and dimeric p53 which model Li-Fraumeni Syndrome patients with germline p53 TD alterations. p53 monomers are inactive forms of the protein. Unexpectedly, p53 dimers conferred some tumor suppression that is not mediated by canonical WT p53 activities. p53 dimers upregulate the PPAR pathway. These activities are associated with lower prevalence of thymic lymphomas and inhibition of CD8+ T-cell accumulation. Lymphomas derived from dimeric p53 mice show cooperating alterations in the PPAR pathway, further implicating a role for these activities in tumor suppression. Our data reveal novel functions for p53 dimers and support the exploration of PPAR agonists as therapies.

2023-03-01 | GSE220963 | GEO

p53 dimers elicit unique tumor suppressive activities through an altered metabolic program [ChIP-seq]

2023-03-01 | GSE220962 | GEO

p53 dimers elicit unique tumor suppressive activities through an altered metabolic program [ATAC-seq]

2023-03-01 | GSE220961 | GEO

p53 dimers elicit unique tumor suppressive activities through an altered metabolic program [scRNA-seq]

2023-03-01 | GSE220965 | GEO

p53 dimers elicit unique tumor suppressive activities through an altered metabolic program [WES]

2023-03-01 | GSE220964 | GEO

Dissociation of β2m from MHC Class I triggers formation of noncovalent, transient heavy chain dimers

Project description:At the plasma membrane of mammalian cells, major histocompatibility complex class I molecules (MHC-I) present antigenic peptides to cytotoxic T cells. Following the loss of the peptide and the light chain beta-2 microglobulin (beta2m), the resulting free heavy chains (FHCs) can associate into homotypic complexes in the plasma membrane. Here, we investigate the stoichiometry and dynamics of MHC-I FHCs assemblies by combining a micropattern assay with fluorescence recovery after photobleaching (FRAP) and with single molecule co-tracking. We identify non-covalent MHC-I FHC dimers mediated by the alpha-3 domain as the prevalent species at the plasma membrane, leading a moderate decrease in the diffusion coefficient. MHC-I FHC dimers show increased tendency to cluster into higher order oligomers as concluded from an increased immobile fraction with higher single molecule colocalization. In vitro studies with isolated proteins in conjunction with molecular docking and dynamics simulations suggest that in the complexes, the alpha-3 domain of one FHC binds to another FHC in a manner similar to the beta2m light chain.

2022-05-11 | PXD033485 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data