Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

5 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Chico mutant

ABSTRACT: Comparison of wild type and heterozygote and homozygote chico mutants ( Clancy, et al. Extension of Life-Span by Loss of CHICO, a Drosophila Insulin Receptor Substrate Protein. Science 292 (5514), 104.) on Affymetrix Drosophila2 GeneChip. The flies (Drosophila melanogaster) are 7 day old adult females.

ORGANISM(S): Drosophila melanogaster

SUBMITTER: Eugene Schuster

PROVIDER: E-MEXP-1099 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Evolutionary conservation of regulated longevity assurance mechanisms.

McElwee Joshua J JJ Schuster Eugene E Blanc Eric E Piper Matthew D MD Thomas James H JH Patel Dhaval S DS Selman Colin C Withers Dominic J DJ Thornton Janet M JM Partridge Linda L Gems David D

Genome biology 20070101 7

<h4>Background</h4>To what extent are the determinants of aging in animal species universal? Insulin/insulin-like growth factor (IGF)-1 signaling (IIS) is an evolutionarily conserved (public) regulator of longevity; yet it remains unclear whether the genes and biochemical processes through which IIS acts on aging are public or private (that is, lineage specific). To address this, we have applied a novel, multi-level cross-species comparative analysis to compare gene expression changes accompanyi ...[more]

PMID: 17612391

Similar Datasets

Transcription profiling of four mouse tissues following acute caloric restriction

Project description:Multi-tissue transcriptional response following acute caloric restriction in mice.

2007-05-17 | E-MEXP-748 | biostudies-arrayexpress

A combinatorial code for pattern formation in Drosophila oogenesis

Project description:Two-dimensional patterning of the follicular epithelium in Drosophila oogenesis is required for the formation of three-dimensional eggshell structures. Our analysis of a large number of published gene expression patterns in the follicle cells suggests that they follow a simple combinatorial code based on six spatial building blocks and the operations of union, difference, intersection, and addition. The building blocks are related to the distribution of inductive signals, provided by the highly conserved epidermal growth factor receptor and Decapentaplegic (DPP) pathways. We demonstrate the validity of the code by testing it against a set of patterns obtained in a large-scale transcriptional profiling experiment. Using the proposed code, we distinguish 36 distinct patterns for 81 genes expressed in the follicular epithelium and characterize their joint dynamics over four stages of oogenesis. The proposed combinatorial framework allows systematic analysis of the diversity and dynamics of two-dimensional transcriptional patterns and guides future studies of gene regulation. Keywords: EGFR, BMP, gain/loss-of-function RNA was isolated from hand dissected, stage 9-10 egg chambers. Five genetic backgrounds were profiled including: wild type, EGFR gain of function, EGFR loss of function, BMP gain of function, and BMP loss of function. Three biological replicates were hybridized for each pathway perturbation. The samples were split across two rounds of hybridization. Each round of hybridizations included three biological replicates for wild type: The first round included EGFR gof, EGFR lof, BMP gof, and wild type controls A1-A3 (GSM313514-16). For these 12 arrays the extraction, labeling, and hybridization steps were done in parallel. The second round included the BMP lof and wild type controls B1-B3 (GSM313517-19). For these 6 arrays, the extraction, labeling, and hybridization steps were done in parallel.

2008-11-11 | E-GEOD-12477 | biostudies-arrayexpress

The Regulatory Specificity of a Homeodomain Protein is Determined by Unique DNA-Binding Sequences

Project description:Homeodomain (HD) proteins comprise a large family of evolutionarily conserved transcription factors (TFs) having diverse developmental functions, yet they paradoxically recognize very similar DNA sequences. To investigate how HDs control cell-specific gene expression patterns, we determined the DNA binding specificities of a broad range of HDs critical for Drosophila embryonic mesoderm development. These studies revealed particular sequences that are bound by one HD and not by others. Such HD-preferred binding sites are overrepresented in the noncoding regions of genes that are regulated by the corresponding HD. Moreover, we show at single-cell resolution in intact embryos that the HD Slouch (Slou) controls myoblast gene expression through unique DNA sequences that are preferentially bound by Slou. These findings demonstrate that the sequence of a HD-binding site dictates which HD family member binds to and regulates a particular enhancer. This represents a novel mechanism for how cell type-specific TFs induce the distinct genetic programs of individual embryonic cells. Mesodermal cells were profiled from wild type, slou gain-of-function and msh gain-of-function backgrounds.

2012-02-08 | E-GEOD-27163 | biostudies-arrayexpress

Two Forkhead transcription factors regulate the division of cardiac progenitor cells by a Polo-dependent pathway

Project description:The development of a complex organ requires the specification of appropriate numbers of each of its constituent cell types, as well as their proper differentiation and correct positioning relative to each other. During Drosophila cardiogenesis, all three of these processes are controlled by jumeau (jumu) and Checkpoint suppressor homologue (CHES-1-like), two genes encoding forkhead transcription factors that we discovered utilizing an integrated genetic, genomic and computational strategy for identifying novel genes expressed in the developing Drosophila heart. Both jumu and CHES-1-like are required during asymmetric cell division for the derivation of two distinct cardiac cell types from their mutual precursor, and in symmetric cell divisions that produce yet a third type of heart cell. jumu and CHES-1-like control the division of cardiac progenitors by regulating the activity of Polo, a kinase involved in multiple steps of mitosis. This pathway demonstrates how transcription factors integrate diverse developmental processes during organogenesis. GFP-positive and GFP-negative cells were profiled from Stage 11 TinD-GFP Drosophila embryos

2011-06-06 | E-GEOD-29573 | biostudies-arrayexpress

Expression analysis of zebrafish TIF1g-deficient, cdc73 deficient and double-deficient embryos

Project description:Investigation of whole genome gene expression level changes in zebrafish TIF1g-deficient, cdc73 deficient and double-deficient embryos, compared to the wild-type ebryos. A twelve-chip study using total RNA isolated from gata1-GFP positive cells (sorted by FACS) from 12 somite-stage wild type embryos, TIF1g morholino injected, Cdc73 morpholino injected and double morpholino injected embryos.

2010-07-13 | E-GEOD-20432 | biostudies-arrayexpress

Effects of E. coli Shiga toxin on the gene expression profile of human microvascular endothelial cells

Project description:Changes in endothelial phenotype induced by E. coli-derived Shiga toxins (Stx) are believed to play a critical role in the pathogenesis of hemolytic uremic syndrome. Stx inactivate host ribosomes, but also alter gene expression at concentrations that minimally affect global protein synthesis. The effect of Stx on the gene expression profile of human microvascular endothelial cells was examined using the Affymetrix HG-U133A platform. Data were processed using 13 different methods and revealed 369 unique differentially expressed genes, 318 of which were up-regulated and 51 of which were down-regulated. These studies implicated activation of the CXCR4/CXCR7/SDF-1 chemokine pathway in Stx-mediated pathogenesis. Primary human dermal microvascular endothelial cells were treated with vehicle or Shiga toxin (10 fM, 24 h, n = 6) and changes in steady-state mRNA levels were determined by hybridization to Affymetrix HG-U133A arrays

2011-10-10 | E-GEOD-32710 | biostudies-arrayexpress

shRNA profiling of melanoma A375 cells stably expressing a shRNA construct for doxycycline-inducible knockdown of B-Raf (2 mg/ml Dox, antitumor efficacy of RAF inhibitor GDC-0879 involving BRAFV600E mutational status and ERK/MAPK pathway suppression

Project description:Unsupervised hierarchical clustering revealed a strong similarity in gene modulation resulting from either compound treatment or BRAF ablation mediated by RNA interference relative to DMSO-treated control samples . Experiment Overall Design: We have generated melanoma A375 cells stably expressing a shRNA construct for doxycycline-inducible knockdown of B-Raf (2 mg/ml Dox, 48h). Small molecule treatment was at 1000nM R341787, 24h.

2009-10-10 | E-GEOD-13487 | biostudies-arrayexpress

Quantitative modeling of transcription factor binding specificities using DNA shape

Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).

2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress

RNAi profiling by array of Drosophila salivary glands upon NSL3, MCRS2 and MBDR2 RNAi mediated depletion

Project description:Expression profiling of NSL3, MCRS2 and MBDR2 RNAi-mediated depletion in Drosophila salivary glands. This experiment is related to experiment E-MTAB-214

2010-06-25 | E-MEXP-2652 | biostudies-arrayexpress

Endogenous expression of an oncogenic PI3K mutation leads to activated PI3K pathway signaling and an invasive phenotype

Project description:The PTEN/PI3K pathway is commonly mutated in cancer and therefore represents a rational target for therapeutic intervention. In order to investigate the primary phenotype(s) mediated by mutant PIK3CA in a clean and highly patient-relevant context, we utilized a non-tumorigenic MCF10A parental and isogenic knock-in cell line that harbors a common activating PIK3CA kinase domain mutation (H1047R). We found that introduction of an endogenously mutated PIK3CA primarily results in a marked epithelial-mesenchymal transition (EMT) and invasive phenotype compared to isogenic wild-type cells. Moreover, a potent and selective inhibitor of PIK3CA (GDC-0941) was highly effective and selective on reversing this phenotype compared to cell-proliferation, highlighting a potential new paradigm for studying PI3K-pathway targeted agents. Keywords: Expression Array Gene expression profiles from a parental MCF10A breast line and an MCF10A clone that has a PI3K activating mutation (H1047R) knocked-in. We plated the cells in 10cm dishes overnight in media with serum, but lacking EGF or insulin. DMSO or GDC-0941 (PI3K inhibitor) at an EC50 concentration were added to triplicate plates of cells in the morning. After 4 hours the RNA was harvested using the Qiagen RNeasy kit. There are 12 samples total.

2011-08-09 | E-GEOD-17785 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data