Transcription profiling of melon fruit during ripening and cotyledons and roots in response to viral and fungal infections
Ontology highlight
ABSTRACT:
ORGANISM(S): Cucumis melo
DISEASE(S): Monosporascus cannonballus infected
SUBMITTER: joaquin Canizares
PROVIDER: E-MEXP-2334 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Time series response of potato cv. Désirée, which is tolerant to PVY infection, was analysed in both inoculated as well as upper non-inoculated leaves. Additionally, transgenic plants deficient in accumulation of salicylic acid (NahG- Désirée) were studied in the same setting.
2019-09-25 | PXD015221 | Pride
Project description:Nonhost resistance, a resistance of plant species against all nonadapted pathogens, is considered the most durable and efficient immune system in plants. To increase our understanding of the response of barley (Hordeum vulgare L.) plants to infection by powdery mildew, Blumeria graminis f. sp. Tritici, we used quantitative proteomic analysis (LC-MS/MS). We compared the response of two genotypes of barley cultivar Golden Promise, wild type (WT) and plants with overexpression of phytoglobin (previously hemoglobin) class 1 (HO), which has previously been shown to significantly weaken non-host resistance. A total of 8804 proteins were identified and quantified, out of which the abundance of 1044 proteins changed significantly in at least one of the four comparisons (‘i’ stands for ‘inoculated’)- HO/WT and HOi/WTi (giving genotype differences), and WTi/WT and HOi/HO (giving treatment differences). Among these differentially abundant proteins (DAP) were proteins related to structural organization, disease/defense, metabolism, transporters, signal transduction and protein synthesis. More proteins changed in abundance in WT than in HO after inoculation and most DAP increased in abundance.
2020-08-18 | PXD015089 | Pride
Project description:microRNAs can play a crucial role in stress response in plants, including biotic stress. Some miRNAs are known to respond to bacterial infection. This work has addressed the role of miRNAs in Manihot esculenta (cassava)-Xanthomonas axonopodis pv. manihotis (Xam) interaction. Illumina sequencing was used for analyzing small RNA libraries from cassava tissue infected and non-infected with Xam. Cassava variety MBRA685 (resistant to Xam-CIO151) Six-week-old plants were inoculated with 36h-old cultures of the aggressive Xanthomonas axonopodis pv. manihotis strain CIO151 in both leaves and stems. Leaves were inoculated by piercing six holes in the mesophyll and placing a 5µL drop of a liquid Xam-MgCl2 culture calibrated at OD600nm = 0.002 (1 x108cfu/ml). Two leaflets per leaf and three leaves per plant were inoculated. Stems were inoculated by puncture in the stems as described previously (24). At least three plants per collection time were inoculated. Leaves and stems were collected from inoculated plants (0 hours post inoculation -hpi, 6hpi, 24hpi, 2 days post-inoculation -dpi, 5dpi, 7dpi and 15dpi) and non-inoculated plants. RNA extractions were made using a LiCl-acid phenol:chloroform method.
2011-12-01 | E-GEOD-29379 | biostudies-arrayexpress
Project description:GmMYB176 is an R1 MYB transcription factor that regulates multiple genes in the isoflavonoid biosynthetic pathway thereby affecting isoflavonoid level in soybean roots. While GmMYB176 is important for isoflavonoid synthesis, it is not sufficient for the function and requires additional cofactor (s). The aim of this study was to identify GmMYB176 interactome for the regulation of isoflavonoid biosynthesis in soybean. GmMYB176 interactome was identified by Co-Immunoprecipitation using two YFP-tagged proteins baits, N’-GmMYB176-YFP-C’ and N’-YFP-GmMYB176-C’. GmMYB176 interacting proteins were identified by LC-MS/MS.
2021-02-03 | PXD023931 | Pride
Project description:We used Arabidopsis full-genome microarrays to characterize plant transcript accumulations at different stages of infection with the biotrophic oomycete downy mildew pathogen, Hyaloperonospora arabidopsidis : initiation (< 1 dpi) and maintenance of infection (> 4 dpi). In two independent experiments, cotyledons from the ecotype Wassilewskija (WS) were inoculated with water, or with Hyaloperonospora arabidopsidis to establish a compatible interaction. Affymetrix ATH1 microarrays were used to profile Arabidopsis transcript accumulations at the initiation (mixed samples at 8 and 24 hours post inoculation, hpi; early stage) and maintenance (mixed samples at 4 and 6 days post inoculation; late stage) of the compatible interaction.
2010-04-07 | E-GEOD-21076 | biostudies-arrayexpress
Project description:Virus infection triggers widespread silencing of host genes by a distinct class of endogenous siRNAs in Arabidopsis This study constructed and sequenced two independent small RNA libraries from the upper uninoculated leaves of (i) WT Arabidopsis plants 14 d after mock inoculation and of (ii) rdr1 rdr6 plants 14 d after infection with Fny CMV-Δ2b, and one library each from the upper uninoculated leaves of (iii) WT, (iv) rdr1, and (v) rdr6 plants 14 d after infection with TuMV-GFP. Coimmunoprecipitation with FLAG- and HA-specific antibodies was used to obtain (vi,vii) AGO1 and (viii,ix) AGO2 complexes, respectively, from the FLAG-AGO1/ago1-36 and HA-AGO2 plants 14 d after infection with Fny CMV-Δ2b for extracting total loaded small RNAs for the construction and sequencing of small RNA libraries.
2014-08-30 | E-GEOD-60929 | biostudies-arrayexpress
Project description:Abscisic acid (ABA) determines mycorrhiza functionality and arbuscule development. Transcriptome analysis in response to different mycorrhization status according to the ABA concentration in the root was performed to identify genes that may play a role in arbuscule functionality. Tomato Affymetrix GeneChip (around 10,000 probes) allowed us to detect and compare the transcriptional root profiling of tomato (Solanum lycopersicum) wild-type and ABA-deficient sitiens plants colonized by the arbuscular mycorrhizal fungus Glomus intraradices. <br><br>
2010-07-01 | E-MEXP-2356 | biostudies-arrayexpress
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:Powdery mildew, caused by the fungus Blumeria graminis (DC) Speer, is one of the most important foliar diseases of cereals worldwide. It is an obligate biotrophic parasite, colonising leaf epidermal cells to obtain nutrients from the plant cells without killing them. Syringolin A (sylA), a circular peptide secreted by the phytopathogenic bacterium Pseudomonas syringae pv. syringae, triggers a hypersensitive cell death reaction (HR) at infection sites when sprayed onto powdery mildew infected wheat which essentially eradicates the fungus. The rational was to identify genes whose expression was specifically regulated during HR, i.e. genes that might be involved in the switch of compatibility to incompatibility.<br>Powdery mildew-infected or uninfected plants were treated with syringolin two days after infection and plant material for RNA extraction was collected at 0.5, 1, 2, 4, 8, 12 hours after treatment (hat), resulting in an early (2 and 4 hat) and late pool (8 and 12 hat). Plant material that was uninfected prior to syringolin treatment was collected 8 and 12 hat (late pool of uninfected plant material), and 1 hat, respectively.
2006-06-30 | E-MEXP-739 | biostudies-arrayexpress
Project description:Tomato fruit ripening is associated with a dramatic increase in susceptibility to the fungal pathogen Botrytis cinerea, the causal agent of gray mold. Mature green fruit, prior to ripening, are largely resistant to B. cinerea, whereas red fruit, at the end of ripening, are susceptible to B. cinerea infection. We used microarrays to detail the gene expression changes that are induced by B. cinerea when tomato fruit at unripe and ripe stages are infected. Experiment Overall Design: Tomato fruit at mature green and red ripe stages were wound inoculated with a water suspension of B. cinerea conidia. Twenty four hours post inoculation fruit pericarp and epicarp tissue around and including the inoculation sites was collected and the total RNA extracted. Total RNA was also collected from healthy and mock inoculated fruit.
2009-06-01 | E-GEOD-14637 | biostudies-arrayexpress