Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0

Transcription profiling of tomato infected with mild and aggressive Pepino mosaic virus to investigate differential host responses


ABSTRACT: Plant and virus materials, inoculation and symptom evaluation

Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008).

The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).



Microarray sample preparation and determination of viral titers

Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007).

Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).

ORGANISM(S): Lycopersicon esculentum

DISEASE(S): 12 DAI with PepMV-EU isolate

SUBMITTER: Peter van Esse 

PROVIDER: E-MEXP-2389 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

Similar Datasets

2009-01-17 | E-MEXP-1994 | biostudies-arrayexpress
2006-04-01 | E-MEXP-387 | biostudies-arrayexpress
2010-07-01 | E-MEXP-2356 | biostudies-arrayexpress
2009-08-06 | E-GEOD-17156 | biostudies-arrayexpress
2012-03-12 | E-MEXP-3388 | biostudies-arrayexpress
2007-12-08 | E-MEXP-404 | biostudies-arrayexpress
2010-09-30 | E-MEXP-2622 | biostudies-arrayexpress
2012-10-11 | GSE41131 | GEO
2022-05-24 | GSE203627 | GEO
2006-02-01 | E-MEXP-386 | biostudies-arrayexpress