Transcriptional profile in TECs
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Geraldo Passos
PROVIDER: E-MEXP-3214 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies, Coralville, IA, USA) anti-Aire RNAi sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) in order to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10nM of anti-Aire siRNA using Hiperfect reagent (Qiagen, GmbH, Hilden, Germany) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kitM-. (Ambion, Austin, TX, USA), which served as template for cDNA synthesis.<br><br>Gene knockdown was confirmed by quantitative reverse transcription PCR (qRT-PCR) using the primers 5_-GCAACTCTGGCCTCAAAGAG-3_ forward and 5_-GGTCTGAATTCCGTTTCCAA-3_ reverse, which allowed amplification<br><br>of a 120 bp PCR product corresponding to a segment of the Aire cDNA. The cDNA samples were prepared using Superscript II<br><br>reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) enzyme, as recommended. Expression of the above mentioned genes was quantified using a 7500 Real Time PCR System (Applied Biosystems)
2011-08-31 | E-MEXP-3213 | biostudies-arrayexpress
Project description:We used the TriFectaTM (IDT, Integrated DNA Technologies,<br><br>Coralville, IA, USA) anti-Dicer RNAi sequence (AGAACGAAAUGCAAGGAAUGGACTCGAGUCCAUUCCUUGCAUUUCGUUCUUC, ACAAGAAACGGAAUCACAUCACACTAGUGUGAUGUGAUUCCGUUUCUUGUCG, GCAGUUGUCCUAAACAGAUUGAUAAUUAUCAAUCUGUUUAGGACAACUGCUG) to silencing Dicer mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 20 nM of each anti-Dicer siRNA using Hiperfect reagent (Qiagen) following manufacturerM-^Rs instructions. After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by quantitative PCR (qRT-PCR) using the primers 5M-^RCCCAAATGTAGAACCCGAGA 3M-^R forward and 5M-^RCAACCGACACTGTCCATCG 3M-^R reverse, which allowed amplification of a 119 bp PCR product corresponding to a segment of the Dicer mRNA (cDNA). Transcriptional expression levels were determined using a StepOne Real-Time PCR System (Applied Biosystems, USA).
2011-08-30 | E-MEXP-3211 | biostudies-arrayexpress
Project description:The oligo microarrays were used to determine microRNA expression profiles of medullary thymic epithelial cells (mTECs) submitted of in vitro Aire Knockdown (siRNA silencing).
2012-08-21 | E-MEXP-3359 | biostudies-arrayexpress
Project description:Female NOD mice were born in specific pathogen free (SPF) conditions at the CEMIB-UNICAMP animal facility (University of Campinas, S�o Paulo, Brazil) and maintained in SPF mini-isolators in our laboratory at the University of S�o Paulo, Campus of Ribeir�o Preto, Brazil. We studied both pre-diabetic (8�2 week-old) and diabetic (20�2 week-old) animals. Diabetes was confirmed by blood glucose levels (?250 mg glucose/dL) using the Accu Check � Active Kit (Roche Diagn�stica Brasil, S�o Paulo, Brazil). The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells (from pre-diabetic and diabetic animals) and 1x107 mTEC 3.10 cells using Trizol� Reagent and following the manufacturer�s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).
2009-11-16 | E-MEXP-2339 | biostudies-arrayexpress
Project description:DBA/1J and DBA-2/J mice (12-14 weeks old) weighing 18�22 g were housed in temperature-controlled rooms (22�25�C) in the animal facility of the School of Medicine of Ribeir�o Preto, University of S�o Paulo, S�o Paulo, Brazil, and received water and food ad libitum. DBA/1J and DBA-2/J male mice were used in type II collagen immunizations. For CIA, at day zero, DBA/1J males were intradermally injected at the base of the tail with 200 �g of bovine type II collagen (CII) (Sigma) in 100�l of 0.05 M acetic acid emulsified with equal volume of complete Freund�s adjuvant (Chondrex, Redmond, WA). On day 21, a second injection of CII (200 �g in acetic acid) was given intraperitoneally (i.p). DBA/2J males were also immunized with CII and served as controls. A caliper was used to determine the paw diameter and swelling was determined as the increase in diameter compared to day zero of immunization. The thymic stroma was separated from the whole thymus. The mTEC 3.10 medullary thymic epithelial cell line was established from C57BL/6 mice, and the original medullary phenotype was confirmed by immunostaining with anti-cytokeratin monoclonal antibodies. In addition, the CD80+ phenotype was confirmed using fluorescent activated cell sorting (FACS) analysis. Cells were cultured in 10% fetal bovine serum-supplemented RPMI 1640 medium at 37oC and 5% CO2. Total RNA was extracted from 1x107 stromal cells and from 1x107 mTEC 3.10 cells using Trizol� Reagent and following the manufacturer�s instructions (Invitrogen, Carlsbad, CA, USA). RNA preparations were confirmed to be free of proteins and phenol using UV spectrophotometry and the state of degradation was assessed using agarose gel electrophoresis (ethidium bromide staining).
2009-10-01 | E-MEXP-2338 | biostudies-arrayexpress
Project description:We used the TriFecta TM (IDT, Integrated DNA Technologies, USA) anti-Aire siRNA sequence (GGAUUCUCUUUAAGGACUACAAUCTAGAUUGUAGUCCUUAAAGAGAAUCCUC) to silencing Aire mRNA. Confluent cultures of 3.10 mTEC cell line were transfected with 10 nM of anti-Aire siRNA using Hiperfect reagent (Qiagen) following manufacturers instructions. <br><br>After transfection, cells were cultured during 24 h in RPMI medium as above mentioned and total RNA was extracted using the mirVana kit (Ambion), which served as template for cDNA synthesis. Gene knockdown was confirmed by semi-quantitative reverse transcription PCR (RT-PCR) using the primers 5prim CATCCTGGATTTCTGGAGGA 3prim forward and 5prim GCTCTTTGAGGCCAGAGTTG 3prim reverse, which allowed amplification of a 253 bp PCR product corresponding to a segment of the Aire mRNA (cDNA). The PCR mix contained 200 uM dNTPs, 1.5 mM MgCl2, 50 mM KCl, 10 mM TRIS-HCl (pH 8.4), 10 uM each primer and 2 U Taq DNA polymerase. The cycling temperature was: 35 x 30 sec each (94oC, 57oC and 72oC). <br><br>An anti-HPRT siRNA included in this kit but whose sequence was not furnished was used in parallel to evaluate the efficiency of the gene knockdown assay on 3.10 mTEC cell line (data not shown).<br><br>
2009-08-30 | E-MEXP-2181 | biostudies-arrayexpress
Project description:The long term objective is to create an encyclopedia of the expression levels of all genes in multiple components of the developing kidney. The central thesis is straightforward. The combination of fluorescent activated cell sorting (FACS) plus microarray analysis offers a powerful, efficient and effective method for the creation of a global gene expression atlas of the developing kidney. Microarrays with essentially complete genome coverage can be used to quantitate expression levels of every gene in FACS isolated components of the developing kidney. The ensuing rapid read-out provides an expression atlas that is more sensitive, more economical and more complete than would be possible by in situ hybridizations alone. YFP & GFP transgenic lines have been used to isolate several cell types including the metanephric mesenchyme, Juxtaglomerular Complex cells or renal cortex from the kidneys of either E11.5 embryos or adult mice. The various cell types were isolated from the kidney using microdissection and single-cell isolation techniques. RNA was isolated from cells and the gene expression profiles were determined by microarrays.
2012-12-05 | E-GEOD-42713 | biostudies-arrayexpress
Project description:Normal thymic T cell development is enabled by a stromal microenvironment most importantly composed of distinct epithelial cell populations in cortex and medulla. Their differentiation, growth and function require the expression of the transcription factor Foxn1. Direct targets of Foxn1 have, however, remained largely undefined. Utilizing newly created static and inducible genetic model systems, we now provide a genome wide map of Foxn1 target genes and the sequences bound by this master regulator. Foxn1 controls not only essential steps early in intrathymic lymphoid development including T cell lineage commitment but is also indispensable for later stages in T cell maturation such as the selection of CD4 and CD8 T cells. Thus, Foxn1 function critically choreographs both early and late events in thymic lympho-stromal cross-talk. Foxn1 ChIP-seq and RNA-seq in mouse models of hypofunctional or conditional knock-out of Foxn1 Brief sample descriptions are shown below: Foxn1 ChIP-seq (GSM1945905) - chromatin immunoprecipitated using an antibody against FOXN1-FLAG (wt*); 2 samples Input ChIP-seq (GSM1945906) - input chromatin; 2 samples 42cT (GSM1945907) - RNA-seq on wt*/-::nu/nu cTEC; 3 samples 42mT (GSM1945908) - RNA-seq on wt*/-::nu/nu mTEC; 2 samples 96cT (GSM1945909) - RNA-seq on wt*/wt*::nu/nu cTEC; 3 samples 96mT (GSM1945910) - RNA-seq on wt*/wt*::nu/nu mTEC; 2 samples NcT (GSM1945911) - RNA-seq on Dox-treated TetO- iFoxn1(del7,8) cTEC; 5 samples PcT (GSM1945912) - RNA-seq on Dox-treated TetO+ iFoxn1(del7,8) cTEC; 5 samples C57BL/6 mice (GSM1945913) - ATAC-seq on wild-type cTEC; 1 sample Please see each sample for more detailed information.
2016-08-09 | E-GEOD-75219 | biostudies-arrayexpress
Project description:The long term objective is to create an encyclopedia of the expression levels of all genes in multiple components of the developing kidney. The central thesis is straightforward. The combination of fluorescent activated cell sorting (FACS) plus microarray analysis offers a powerful, efficient and effective method for the creation of a global gene expression atlas of the developing kidney. Microarrays with essentially complete genome coverage can be used to quantitate expression levels of every gene in FACS isolated components of the developing kidney. The ensuing rapid read-out provides an expression atlas that is more sensitive, more economical and more complete than would be possible by in situ hybridizations alone. Tie2-GFP transgenic mice were utilized to isolate the endothelial cell population from the glomerulus of adult kidneys. The glomerular endothelial cells were isolated from kidneys using a combination of collagenase treatment, differential seiving, trypsin treatment and FACS. The RNA was isolated from purified endothelial cells and the gene expression profiles were determined by microarrays.
2010-07-29 | E-GEOD-22561 | biostudies-arrayexpress
Project description:The long term objective is to create an encyclopedia of the expression levels of all genes in multiple components of the developing kidney. The central thesis is straightforward. The combination of fluorescent activated cell sorting (FACS) plus microarray analysis offers a powerful, efficient and effective method for the creation of a global gene expression atlas of the developing kidney. Microarrays with essentially complete genome coverage can be used to quantitate expression levels of every gene in FACS isolated components of the developing kidney. The ensuing rapid read-out provides an expression atlas that is more sensitive, more economical and more complete than would be possible by in situ hybridizations alone. Tie2-GFP transgenic mice were utilized to isolate the endothelial cell population from the cortical region of adult kidneys. The cortical endothelial cells were isolated from kidneys using a combination of collagenase treatment, differential seiving, trypsin treatment and FACS. The RNA was isolated from purified endothelial cells and the gene expression profiles were determined by microarrays.
2010-07-30 | E-GEOD-22464 | biostudies-arrayexpress