Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

14 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptional profiling by array of microRNAs from human peripheral blood mononuclear cells of type 2 diabetes mellitus patients

ABSTRACT: The microRNA oligo microarrays were used to determine expression profiles of peripheral blood mononuclear cells from type 2 diabetes mellitus (T2DM) patients, aiming the identification of possible disease related MicroRNAs.

ORGANISM(S): Homo sapiens

SUBMITTER: Geraldo Passos

PROVIDER: E-MEXP-3373 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

Identifying common and specific microRNAs expressed in peripheral blood mononuclear cell of type 1, type 2, and gestational diabetes mellitus patients.

Collares Cristhianna V A CV Evangelista Adriane F AF Xavier Danilo J DJ Rassi Diane M DM Arns Thais T Foss-Freitas Maria C MC Foss Milton C MC Puthier Denis D Sakamoto-Hojo Elza T ET Passos Geraldo A GA Donadi Eduardo A EA

BMC research notes 20131126

<h4>Background</h4>Regardless the regulatory function of microRNAs (miRNA), their differential expression pattern has been used to define miRNA signatures and to disclose disease biomarkers. To address the question of whether patients presenting the different types of diabetes mellitus could be distinguished on the basis of their miRNA and mRNA expression profiling, we obtained peripheral blood mononuclear cell (PBMC) RNAs from 7 type 1 (T1D), 7 type 2 (T2D), and 6 gestational diabetes (GDM) pat ...[more]

PMID: 24279768

Similar Datasets

miRNA post transcriptional control of umbilical cord mesenchymal stem cell osteogenic differentiation.

Project description:Umbilical cord mesenchymal stem cells were stimulated to osteogenesis by 24h, 48h and 7 days. Undifferentiated and treated cells have their total RNA extracted and 25 ug were used to extract micro RNAs by Flash PAGE Fractionator (Ambion). These miRNA were labeled and used to hybridize to 662 oligo arrays corresponding to miRNA sequences from human, rat and mouse. The hybridized slides were scanned in the Amersham Automatic Slide Processor, quantified by TIGR Spotfinder software and submitted to stathiscal treatment in TIGR MEV software.

2011-07-31 | E-MEXP-3080 | biostudies-arrayexpress

MicroRNA profiling by array of control and Aire-knockdown medullary thymic epithelial cells isolated from thymus of BALB-c mice.

Project description:Small interfering RNA ( siRNA) was used to knockdown Autoimmune regulator (Aire) gene by in vivo electroporation of the thymus of BALB-c mice. In this set of data we include control and Aire-knockdown mTEC cells isolated from thymus of BALB-c mice.

2013-06-28 | E-MEXP-3665 | biostudies-arrayexpress

Transcription profiling by array of human bladder cancer cell lines with or without TP53 mutations

Project description:The established cell lines RT4, 5637 and T24 from human bladder TCC were obtained from the Cell Bank of the Federal University of Rio de Janeiro, Brazil. The 5637 cells harbor two TP53 mutations, at codon 72 (Arg . Pro) and codon 280 (Arg . Thr).T24 cells contain a TP53 allele encoding an in-frame deletion of tyrosine 126. Both cell lines were established from high-grade bladder tumors. No specific mutations were detected in RT4 cells, which had been established from a low-grade papillary bladder tumor. The RT4 and T24 cell lines were maintained in DulbeccoM-^Rs modified EagleM-^Rs medium (Sigma-Aldrich, Inc, St Louis, MO, USA), and the 5637 cells were kept in Roswell Park Memorial Institute medium (Sigma-Aldrich). Both media were supplemented with 10% fetal bovine serum (Cultilab Ltd, Campinas, Brazil), 100 U/mL penicillin G (Sigma-Aldrich), 100 U/mL streptomycin (Sigma-Aldrich) and 1% kanamycin sulfate (Amresco, Branded Products Group, Solon, OH, USA); cells were cultured at 37M-:C in an atmosphere of 5% CO2. A pooled reference design was chosen. More specifically, each array was hybridized with the same reference sample labeled with Cy5, while the experimental samples (control or treated) were labeled with Cy3.

2010-10-30 | E-MEXP-2859 | biostudies-arrayexpress

Undifferentiated pulp cells and odontoblast-like cells share genes involved in the process of odontogenesis.

Project description:Undifferentiated pulp cells and odontoblast-like cells share genes involved in the process of odontogenesis.

2012-08-15 | E-MEXP-3637 | biostudies-arrayexpress

Comparative Expression of Human-Mouse Syntenic Genes during Osteoblastic Differentiation of Bone Marrow Mesenchymal Stem Cells

Project description:Comparative analysis of differentially expressed Human-Mouse Syntenic mRNA during Osteoblastic Differentiation of Bone Marrow Mesenchymal Stem Cells

2010-06-22 | E-MEXP-3244 | biostudies-arrayexpress

Transcription Regulatory Networks of CD4 CD8 and CD14 cells in Patients of Type I Mellitus Diabetes

Project description:Insulin-dependent diabetes mellitus (T1D) is an organ-specific auto-immune disease caused by the selective destruction of the pancreatic beta cells by inflammatory cells, especially auto-reactive CD8+ T lymphocytes. In this study we evaluated the differential large scale gene expression profiling using cDNA microarrays of T (CD4+ and CD8+) and monocyte (CD14+) cells. In addition, considering that HLA class II profile may influence the expression of these molecules on the surface of peripheral blood cells, and considering that the mechanisms by which HLA class II susceptibility alleles drive the auto-immune response have not been elucidated, we intend to further stratify T1D patients according to the HLA class II profile. 20 pre-pubertal recently diagnosed T1D patients were selected, HLA-DRB1/DQB1 allele typing and separated in two groups. The group 1(G1) had patients with susceptibility alleles and group 2 (G2) with at least one protection allele. To established relationships between genes, the GeneNetwork 1.2 algorithm was used, 6 networks were obtained, TCD4+ G1 patients X controls, TCD4+ G2 patients X controls, and same situation to TCD8+ and CD14+.

2011-06-15 | E-MEXP-3223 | biostudies-arrayexpress

Transcription profiling of ovarium cancer samples from patients with tumors of different stages and sensitivity to platinum chemotherapy treatment

Project description:We investigated whether prognostic information is reflected in the expression patterns of ovarian carcinoma samples. RNA obtained from seven FIGO stage I without recurrence, seven platin-sensitive advanced-stage (III or IV), and six platin-resistant advanced-stage ovarian tumors was hybridized on a complementary DNA microarray with 21,372 spotted clones. The results revealed that a considerable number of genes exhibit nonaccidental differential expression between the different tumor classes. Principal component analysis reflected the differences between the three tumor classes and their order of transition. Using a leave-one-out approach together with least squares support vector machines, we obtained an estimated classification test accuracy of 100% for the distinction between stage I and advanced-stage disease and 76.92% for the distinction between platin-resistant versus platin-sensitive disease in FIGO stage III/IV. These results indicate that gene expression patterns could be useful in clinical management of ovarian cancer.<br> KEYWORDS: clinical, FIGO stage, microarrays, ovarian cancer, platin resistance.

2007-02-10 | E-MEXP-979 | biostudies-arrayexpress

Transcription profiling of ovarium cancer samples from patients with tumors of different stages, sensitivity to platinum chemotherapy and with no disease recurrence, recurrence or progression to evaluate models of clinical behaviour

Project description:Ovarian cancer is the leading cause of death in gynaecological malignancies in women. However, currently there are no clinical or pathologic parameters available that can reliably predict clinical outcome. In a previously published pilot study we explored the performance of microarrays in predicting clinical behaviour of ovarian tumours. For this purpose we performed microarray analysis on 20 patients and estimated that we could predict disease stage with 100% accuracy and the response to platin-based chemotherapy with 76.92% accuracy using leave-one-out cross validation techniques in combination with Least Squares Support Vector Machines (LS-SVMs). In the current study we prospectively evaluate models, built on the pilot data set, on a set of 49 new patients. Principal component analysis showed that the gene expression data from stage I, platin-sensitive advanced stage and platin-resistant advanced stage tumours in the prospective study did not correspond to their respective classes in the pilot study. Additionally, LS-SVM models built using the data from the pilot study, only misclassified one of four stage I tumours and correctly classified all 45 advanced stage tumours but this model was not able to predict resistance to platin-based chemotherapy. We discuss possible reasons for prospective failure of these models and conclude that existing results based on gene expression patterns of ovarian tumours need to be thoroughly scrutinized before this technology could be considered ready for clinical use.

2007-12-31 | E-MEXP-995 | biostudies-arrayexpress

Transcription profiling by array of mouse wild type and Prss16 knockouts

Project description:Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.

2010-08-31 | E-MEXP-2829 | biostudies-arrayexpress

Osteoblast differentiation of human bone marrow and umbilical cord mesenchymal stem cells

Project description:Search for differentially expressed genes during osteoblast differentiation (0, 24h, 48h and 168h) of human bone marrow or umbilical cord mesenchymal stem cells

2011-01-15 | E-MEXP-3046 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data