RNA-seq of human neuroblastoma cell lines where RET is knocked out
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq 6000
ORGANISM(S): Homo sapiens
SUBMITTER: Ruth Palmer
PROVIDER: E-MTAB-10032 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Aberrant activation of Anaplastic Lymphoma Kinase (ALK) drives neuroblastoma (NB). Previous work has identified the RET receptor tyrosine kinase (RTK) as a downstream target of ALK activity in NB models. We show here that ALK activation in response to ALKAL2 ligand results in the rapid phosphorylation of RET in NB cells, providing additional insight into the contribution of RET to the ALK driven gene signature in NB. To further address the role of RET in NB, RET knock-out (KO) SK-N-AS cells were generated by CRISPR/Cas9 genome engineering. Gene expression analysis of RET KO NB cells identified a reprogramming of NB cells to a mesenchymal (MES) phenotype that was characterized by increased migration and upregulation of the AXL and MET RTKs as well as integrins and extracellular matrix components. Strikingly, the upregulation of AXL in the absence of RET reflects the development timeline observed in the neural crest as progenitor cells undergo differentiation during embryonic development. Together, these findings suggest that a MES phenotype is promoted in mesenchymal NB cells in the absence of RET, reflective of a less differentiated developmental status.
2021-09-10 | PXD024551 | Pride
Project description:RNA-seq of human neuroblastoma cell lines where RET is knocked out
| PRJEB42584 | ENA
Project description:The RET gene has been identified previously as a target of activated ALK at the mRNA level in both human neuroblastoma cell lines and primary tumors as well as in murine tumors driven by mutated Alk and MYCN. Moreover, it has been shown that tumor growth of murine TH-MYCN/KI Alkmut tumors was impaired upon Ret inhibition by the vandetanib inhibitor, suggesting RET as a therapeutic target in ALK mutated neuroblastoma. To further demonstrate the crucial role of RET in ALK mutated driven neuroblastoma oncogenesis, transgenic TH-MYCN mice were bred with KI RetM919T tumors. We document an oncogenic cooperation between activated Ret and MYCN overexpression in neuroblastoma formation. We used microarrays to analyze the global programme of gene expression of MYCN/RetM919T tumors and compare these profiles with profiles of MYCN/Alkmut tumors (GSE46583). Altogether, our data show that MYCN/RetM919T tumors present with expression profiles close to MYCN/Alkmut tumors.
2017-09-15 | GSE72678 | GEO
Project description:ALK is a tyrosine kinase receptor and oncogene in neuroblastoma (NB). The receptor is activated by the ALKAL2 ligand, but it is unknown whether missregulation of this ligand may play a role in NB carcinogenesis. Here, a TH-MYCN driven neuroblastoma mice was created +/- ALK F1178S mutation and +/- ALKAL2 overexpression
2020-11-24 | E-MTAB-9600 | biostudies-arrayexpress
Project description:Anaplastic Lymphoma Kinase (ALK) most frequently mutated in neuroblastoma (NB) and is atractive molecular target for therapy. However, efficacy of the ALK inhibitor against ALK-amplified NB is unclear. To elucidate genetic alterations induced by treatment of the ALK inhibitor, we compared expression profile between ALK inhibitor-treated and DMSO-treated NB39nu cells using Agilent SurePrint G3 Human GE 8x60K V2 Microarray Kit
2017-11-28 | GSE107354 | GEO
Project description:ALK is a tyrosine kinase receptor and oncogene in neuroblastoma (NB). The receptor is activated by the ALKAL2 ligand, but it is unknown whether missregulation of this ligand may play a role in NB carcinogenesis. To characterize the transcriptomic response to ALKAL2 in neuroblastoma cell lines, RNA-Seq was performed on NB1 and IMR32 human NB cell lines.
2020-11-24 | E-MTAB-9598 | biostudies-arrayexpress
Project description:High-risk neuroblastoma (NB) is notoriously difficult to treat and is responsible for a disproportionate number of childhood deaths due to cancer. One long accepted indicator of high-risk NB and poor prognosis is amplification of the neural MYC (MYCN) oncogene, which is currently therapeutically intractable in this patient population. The identification of Anaplastic Lymphoma Kinase (ALK) as an oncogene in NB raised the possibility of using ALK tyrosine kinase inhibitors (TKIs) in the treatment of NB patients who harbor activating ALK mutations. The number of ALK-positive NB patients on primary diagnosis is in the range of 8-10%, a figure that increases substantially in the relapsed patient population. ALK signaling is activated by the ALKAL2 ligand located on the distal portion of chromosome 2, along with the ALK receptor and MYCN loci, in the ‘2p gain’ region that has been associated with NB. The question of whether dysregulation of ALK ligand may also play a role in NB has not been addressed, although notably, one of the first oncogenes described was the v-sis oncogene that shares more than 90% homology with the PDGF ligand. Therefore, we tested whether ALKAL ligand was able to potentiate NB progression in the absence of ALK mutation. We show here that overexpression of ALKAL2 is sufficient to drive rapid onset and penetrant Th-MYCN driven NB in the absence of ALK mutation, and that these tumours are sensitive to ALK TKI therapy. These results suggest that additional NB patients, such as those exhibiting 2p gain, may also benefit from ALK TKI based therapeutic intervention.
2020-11-25 | PXD021792 | Pride
Project description:High-risk neuroblastoma (NB) currently presents significant clinical challenges. MYCN and ALK, which are often involved in high-risk NB, lead to increased replication stress in cancer cells, providing options for therapeutic exploitation. We previously identified an ATR/ALK inhibitor combination as an effective therapeutic approach in two independent genetically modified mouse NB models. Here, we identify an underlying molecular mechanism, in which ALK signalling leads to phosphorylation of ATR and CHK1, supporting an effective DNA damage response. The importance of ALK inhibition is supported by mouse data, in which monotreatment with ATRi resulted in a robust initial response, but subsequent relapse, in contrast to a 14-day ALKi/ATRi combination treatment that resulted in robust and sustained responses. Finally, we show that the remarkable response to the 14-day combined ATR/ALK inhibition protocol reflects a robust differentiation response in the tumour, reprogramming tumour cells to a neuronal/Schwann cell lineage identity. Our results identify a unique ability of ATR inhibition to trigger neuroblastoma differentiation and underscore the importance of further exploring combined ALK/ATR inhibition in NB, particularly in high-risk patient groups with oncogene-induced replication stress.
2023-12-13 | PXD041824 | Pride
Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.
2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress
Project description:The crizotinibâresistant ALKF1174L mutation arises de novo in neuroblastoma (NB) and is acquired in ALK translocation-driven cancers, lending impetus to the development of novel ALK inhibitors with different modes of action. The diaminopyrimidine TAE684 and its derivative ceritinib (LDK378), which are structurally distinct from crizotinib, are active against NB cells expressing ALKF1174L. Here we demonstrate acquired resistance to TAE684 and LDK378 in ALKF1174L-driven human NB cells that is linked to overexpression and activation of the AXL tyrosine kinase and epithelial-to-mesenchymal transition (EMT). AXL phosphorylation conferred TAE684 resistance to NB cells through upregulated ERK signaling. Inhibition of AXL partly rescued TAE684 resistance, resensitizing these cells to this compound. AXL activation in resistant cells was mediated through increased expression of the active form of its ligand, GAS6, which also served to stabilize the AXL protein. Although ectopic expression of AXL and TWIST2 individually in TAE684-sensitive parental cells led to the elevated expression of mesenchymal markers and invasive capacity, only AXL overexpression induced resistance to TAE684 as well. TAE684-resistant cells showed greater sensitivity to HSP90 inhibition than did their parental counterparts, with downregulation of AXL and AXL-mediated ERK signaling. Our studies indicate that aberrant AXL signaling and development of an EMT phenotype underlie resistance of ALKF1174L-driven NB cells to TAE684 and its derivatives. We suggest that the combination of ALK and AXL or HSP90 inhibitors be considered to delay the emergence of such resistance. In order to understand the molecular mechanisms driving resistance to ALK inhibition in ALK-mutated neuroblatoma, we established cell line models of resistance to TAE684, an ALK inhibitor, by treating SH-SY5Y cells (bearing the ALKF1174L mutation) with increasing concentration of this compound over time. We then performed an analysis of gene expression changes genome wide using Affymetrix U133 Plus 2 arrays, by comparing the TAE684-sensitive parental SH-SY5Y cells to the TAE684-resistant SH-SY5Y cells (named SY5Y-TR1). For that experiment, we analyzed gene expression variations by comparing the parental SH-SY5Y (control sample) to the resistant SY5Y-TR1 cells. So 2 samples were analyzed, with 3 replicates run for each.
2015-11-21 | E-GEOD-73292 | biostudies-arrayexpress