DNA-seq of E. coli BL21 (DE3) Evolved in High pH (pH = 9) Terrific Broth Media
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina MiSeq
ORGANISM(S): Escherichia coli BL21(DE3)
SUBMITTER: Suraj Mital
PROVIDER: E-MTAB-12334 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Bulk RNA-sequencing was performed on E. coli BL21 (DE3) evolved at 25°C in pH 9 terrific broth media buffered with Tris-HCl (pH 9). The evolved E. coli was characterised and compared to the parent strain during protein expression; the strains were actively grown and compared for gene expression at pH 7 and pH 9 in terrific broth media.
2023-10-31 | E-MTAB-12337 | biostudies-arrayexpress
Project description:Binding of transcription factors to DNA is mediated by the recognition of the chemical signatures of the DNA bases and the three-dimensional shape of the DNA molecule. The direct contribution of DNA shape to DNA-binding specificity has been difficult to assess, as DNA shape is a consequence of its sequence. Here, we teased apart these two modes of recognition in the context of Hox-DNA binding. We made a series of mutations in Hox residues that, in a co-crystal structure, only recognize DNA shape, and tested the effect on DNA binding preferences using SELEX-seq. Analysis of shape features of selected sequences revealed that these residues are both necessary and sufficient for selection of sequences with distinct shape features. We used statistical machine learning to show that the accuracy of binding specificity predictions improves by adding shape features to a model that only depends on sequence. We conclude that shape readout is a direct and critical component of binding site selection by Hox proteins. Three rounds of SELEX were performed on a series of Hox mutants as described in Slattery et al, Cell, 2011 (PMID 22153072) and Riley et al, Methods in molecular Biology, 2014 (PMID 25151169). Briefly, His-tagged Scr and Antp mutant proteins were incubated with a randomized 16mer oligonucleotide library, and bound DNA was amplified and sequenced as described (PMID 22153072, PMID 25151169).
2015-01-21 | E-GEOD-65073 | biostudies-arrayexpress
Project description:The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1-8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2'-hydroxyl groups pre-organizing the backbone of nucleotides 2-8 in a near-A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide-target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation results and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for cleavage. Employ high-throughput sequencing of small RNAs extracted from soluble or crystalline K. polysporus Ago1(207-1251) that had been purified from E. coli
2012-05-14 | E-GEOD-37724 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE37723: Degradome sequencing from S. castellii GSE37724: Bacteria-derived small RNAs that co-purify with KpAGO Refer to individual Series
2012-05-13 | E-GEOD-37725 | biostudies-arrayexpress
Project description:The goal of this experiment was to assess whether transcription happens during mitosis. For this, we isolated mitotic HeLa cells and treated them with a transcription inhibitor, ActD.
2018-08-28 | E-MTAB-6661 | biostudies-arrayexpress
Project description:The lysine-specific demethylase 2A gene (KDM2A) is ubiquitously expressed and its transcripts consist of several alternatively spliced forms, including KDM2A and the shorter form N782 that lacks the 3’ end encoding F-box and LRR. KDM2A binds to numerous CpG-rich genomic loci and regulates various cellular activities; however, the mechanism of the pleiotropic function is unknown. Here, we identify the mechanism of KDM2A played by its CXXC-PHD domain. KDM2A is necessary for a rapid proliferation of post-natal keratinocytes while its 3’ end eclipses the stimulatory effect. EGFP-N782 binds to chromatin together with the XRCC5/6 complex, and the CXXC-PHD domain regulates the CpG-rich IGFBPL1 promoter. In vitro, CXXC-PHD enhances binding of nuclear extract ORC3 to the CpG-rich promoter, but not to the AT-rich DIP2B promoter to which ORC3 binds constitutively. Furthermore, CXXC-PHD recruits 94 nuclear factors involved in replication, ribosome synthesis, and mitosis, including POLR1A to the IGFBPL1 promoter. This recruitment is unprecedented; however, the result suggests that these nuclear factors bind to their cognate loci, as substantiated by the result that CXXC-PHD recruits POLR1A to the rDNA promoter. We propose that CXXC-PHD promotes permissiveness for nuclear factors to interact, but involvement of the XRCC5/6 complex in the recruitment is undetermined.
2019-06-28 | PXD012941 | Pride
Project description:Based on the hypothesis that, enhancing the local concentration of donor oligos could increase the correction rates, we generated and tested novel CRISPR-Cas9 systems, in which the DNA repair template is covalently conjugated to Cas9 (RNPD system). To validate our results from the HEK293T reporter cells, we here tested our approach at different endogenous genomic loci and in different cell types. We first targeted the human beta globin (HBB) locus in the K562 cell line, and analyzed correction- and editing frequencies using next generation sequencing (NGS). Next we targeted the Rosa26 and proprotein convertase subtilisin/kexin type 9 (Pcsk9) locus in mouse embryonic stem cells (mESCs). Here, RNPD system was always compared to Cas9 SNAP-tag fusion proteins with uncoupled donor oligos. To also directly compare the engineered RNPD system to the classical CRISPR-Cas9 system, we performed experiments where we used wild-type Cas9 with the uncoupled donor oligos as a control. We therefore targeted the fluorescent reporter locus as well as the endogenous loci HBB, empty spiracles homeobox 1 (EMX1), and C-X-C chemokine receptor type 4 (CXCR4) in HEK293T cells. Finally, we performed the analysis of three computationally predicted off-target sites of the reporter locus.
2018-06-04 | E-MTAB-6808 | biostudies-arrayexpress
Project description:Purpose: The goals of this study are to analyze the transcriptome of five time point in broccoli seed germination and sprout development and to find the putative glucosinolate metabolism genes in the stage. Methods: Total mRNA of germinated seeds, 3 day cotyledons, 7 day botyledons, 11 day cotyledons and 11 day euphyllas of wild-type broccoli were harvested. Each sample was harvested in three independent biological replicates with equal weight and subsequently pooled together for sequencing. The sequence reads that passed quality filters were de novo assembled using VELVET followed by OASES. Then the assembled unigenes were used for the abundance and functional analysis. Results: A total of ~85million 251bp reads were obtained. After de novo assembly and searching the assembled transcripts against the Arabidopsis thaliana and Nr databases, 19,441 top-hit transcripts were clustered as unigenes with an average length of 2,133bp. These unigenes were classified according to their putative functional categories. Cluster analysis of total unigenes with similar expression patterns and differentially expressed unigenes among different tissues,as well as transcription factor analysis were performed. We identified 25 putative glucosinolate metabolismgenes sharing 62.04-89.72% nucleotide sequence identity with the Arabidopsis orthologs. This established a broccoli glucosinolate metabolic pathway with high colinearity to Arabidopsis. Many of the biosynthetic and degradation genes showed higher expression after germination than in seeds; especially the expression of the myrosinaseTGG2 was 20-130 times higher.These results along with the previous reports that glucosinolate concentration decreased exponentially once after germination indicate the breakdown products of glucosinolates may play important roles in broccoli seed germination and sprout development. Conclusion: Our study provides the largest genetic resource of broccoli to date. These data will pave the way for further studies and genetic engineering of broccoli sprouts to develop functional vegetables containing high levels of the anticarcinogenic glucosinolates. They will also provide new insight into the genomic research of this species and its relatives. Wild-type broccoli mRNA profiles of seeds, 3 day cotyledons, 7 day botyledons, 11 day cotyledons and 11 day euphyllas were generated by deep sequencing, three biological replicates pooling together for each tissue, using Illumina Myseq platform.
2014-03-18 | E-GEOD-53298 | biostudies-arrayexpress
Project description:New genes contribute substantially to adaptive evolutionary innovation, but the functional evolution of new mammalian genes has been little explored at a broad scale. Previous work established mRNA-derived gene duplicates, known as retrocopies, as useful models for the study of new gene origination. Here we combine extensive mammalian transcriptomic and epigenomic data to unveil the processes underlying the evolution of stripped-down retrocopies into complex new genes. We show that although some robustly expressed retrocopies are transcribed from preexisting promoters, the majority evolved new promoters from scratch or recruited proto-promoters in their genomic vicinity. In particular, many retrocopy promoters emerged from ancestral enhancers or bivalent regulatory elements, as well as from CpG islands not associated to other genes. Altogether, these mechanisms facilitated the birth of up to 280 retrogenes in each therian species. Furthermore, the regulatory evolution of the originally monoexonic retrocopies was frequently accompanied by exon gain, which facilitated the cooption of distant promoters and in many cases allowed the expression of alternative isoforms. While young retrogenes are often initially expressed in the testis, increased regulatory and structural complexities allowed retrogenes to functionally diversify and evolve somatic organ functions, sometimes as complex as those of their parents. Thus, some retrogenes evolved the capacity to temporarily substitute their parents during the process of male (meiotic) X inactivation, while others even rendered parental functions completely superfluous, allowing for parental gene loss. Overall, our reconstruction of the complete â??life historyâ?? of mammalian retrogenes highlights the usefulness of retroposition as a general model for understanding new gene birth and functional evolution. Assembly and expression of vertebrate retrogene transcripts
2015-12-16 | E-GEOD-72236 | biostudies-arrayexpress
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress