Rhizogenic Agrobacterium protein RolB interacts with the TOPLESS and NINJA repressor proteins to reprogram plant jasmonate signaling.
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq 6000
ORGANISM(S): Solanum lycopersicum
SUBMITTER: Plant Systems Biology data submission
PROVIDER: E-MTAB-12405 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Autophagosomes are double-membraned vesicles that traffic harmful or unwanted cellular macromolecules to the vacuole for recycling. Although autophagosome biogenesis has been studied extensively, autophagosome maturation, i.e., delivery and fusion with the vacuole, remains largely unknown in plants. To start filling these gaps, we devised a differential centrifugation set up, where we enriched intact autophagosomes and performed affinity purification-mass spectrometry (AP-MS), using ATG8 as a bait. This method enabled the identification of an autophagy adaptor protein.
2022-10-18 | PXD031787 | Pride
Project description:The expression of the soluble protein GPNMB (glycoprotein non-metastatic melanoma protein B) induces an aggressive behavior of tumor cells by promoting proliferation and distant spread. The main molecular feature is the over expression of interleukin Il-33. The gene profile of MCA-1-GPNMB and MCA-1-GPNMB-spheroid cell line was assessed against MCA-1-Mock.
2020-07-30 | E-MTAB-8082 | biostudies-arrayexpress
Project description:Nonhost resistance, a resistance of plant species against all nonadapted pathogens, is considered the most durable and efficient immune system in plants. To increase our understanding of the response of barley (Hordeum vulgare L.) plants to infection by powdery mildew, Blumeria graminis f. sp. Tritici, we used quantitative proteomic analysis (LC-MS/MS). We compared the response of two genotypes of barley cultivar Golden Promise, wild type (WT) and plants with overexpression of phytoglobin (previously hemoglobin) class 1 (HO), which has previously been shown to significantly weaken non-host resistance. A total of 8804 proteins were identified and quantified, out of which the abundance of 1044 proteins changed significantly in at least one of the four comparisons (‘i’ stands for ‘inoculated’)- HO/WT and HOi/WTi (giving genotype differences), and WTi/WT and HOi/HO (giving treatment differences). Among these differentially abundant proteins (DAP) were proteins related to structural organization, disease/defense, metabolism, transporters, signal transduction and protein synthesis. More proteins changed in abundance in WT than in HO after inoculation and most DAP increased in abundance.
2020-08-18 | PXD015089 | Pride
Project description:Identification of TRPS1 interactors in MCF7 breast cancer cell line.
2018-07-17 | PXD010312 | Pride
Project description:In order to better understand bacterial aggregates mechanisms we used RNA seq and a specific setup of E. coli K12 strains expressing either the natural self-recognizing adhesin Ag43 or nanobodies based synthetic adhesins. We studied the changes in gene expression between aggregates and planktonic cells.
2023-12-30 | E-MTAB-11396 | biostudies-arrayexpress
Project description:Identification of TRPS1 interactors in MCF7, T47D and ZR75-1 breast cancer cell lines.
2018-06-12 | PXD009863 | Pride
Project description:This study aims to assess the reliability of spike-in normalization for analyzing single-cell RNA sequencing data. This is done by performing mixture experiments where two different sets of spike-in RNA (ERCC and SIRV) are added separately to a single mouse cell (416B or trophoblast stem cells (TSCs)), followed by generation of sequencing libraries using a modified version of the Smart-seq2 protocol. The aim is to measure the variance of the log-ratio of the total counts between the two spike-in sets. This will quantify how precisely the spike-in RNA was added to each well. As a control, addition was also performed with a premixed solution of both spike-ins, to quantify the variability in the log-ratios due to the experimental protocol. The same data can also be used to measure the well-to-well variability in the differences in behaviour between the two spike-in sets. The data contain four batches of libraries (block), using different batches of cells that were processed and sequenced separately. Each batch contains libraries with all three types of spike-in addition (ERCC+SIRV, SIRV+ERCC or Premixed). The 416B cells also contain a CBFB-MYH11 oncogene, which is expressed in half of the cells (Induced) and silent in the other half (Control).
2017-05-31 | E-MTAB-5522 | biostudies-arrayexpress
Project description:Plant and virus materials, inoculation and symptom evaluation<br><br>Tomato seedlings, cultivar Tricia (De Ruiter seeds, Bergschenhoek, the Netherlands) were grown in stonewool in climate chamber conditions (22 and 20°C during day and night periods of 10 and 14 hours, respectively, at 75% relative humidity). At 29 days after planting, plants were inoculated with a mild (1906; GenBank accession number FJ457096) and an aggressive (PCH 06/104; GenBank accession number FJ457097) PepMV isolate of the CH2 genotype. Here, a PepMV isolate is defined as the viral inoculum derived from PepMV infected plants from one specific tomato production site. After inoculation, the genotype of both isolates was determined using a previously described RT-PCR-RFLP method (Hanssen et al., 2008). Inoculation was performed on the second fully developed leaf as previously described (Hanssen et al., 2008). <br><br>The phenotypic response of tomato seedlings upon inoculation was evaluated by recording the development of typical nettlehead-like PepMV symptoms at 4, 8 and 12 days post inoculation (DPI) on 20 plants per treatment. PepMV induced nettlehead-like symptoms are characterized by a reduced leaf surface, leaf bubbling and leaf deformation (Hanssen et al., 2008). Symptoms were scored from 0 (no symptoms) to 3 (severe symptoms) (Figure 1b). Significant (p<0.05) differences in symptom scores were identified by analysis of variance (one-way ANOVA) and post-hoc Bonferroni tests using SPSS software (v. 10.0; SPSS Inc., Chicago, IL, USA).<br><br><br><br>Microarray sample preparation and determination of viral titers<br><br>Tomato genes that were differentially regulated (more than twofold change with P value < 0,001) upon inoculation with the aggressive and mild PepMV isolates were identified at 4, 8 and 12 DPI using mock-inoculated control plants as a reference. At each time point, the youngest fully developed leaves from CH2 mild, CH2 aggressive and mock-inoculated plants were sampled for tomato gene chip hybridizations. Each plant was sampled only once. Three biological replicates, each consisting of pooled RNA extracts obtained from the youngest fully developed leaves of two seedlings, were analyzed per treatment. Total RNA was extracted using the RiboPure RNA extraction kit (Ambion) and reverse transcribed with labeled oligo-dT primers for hybridization onto custom-designed Affymetrix tomato GeneChip arrays (Syngenta Biotechnology, Inc., Research Triangle Park, North Carolina, US) that contains probe sets to interrogate 22,721 tomato transcripts (Van Esse et al., 2007). <br><br>Viral accumulation was measured using a PepMV-specific RT-qPCR assay with forward primer Pep5 (5' ATGAAGCATTCATACCAAAT 3') and reverse primer Pep4 (5' AATTCCGTGCACAACTAT 3'; Mumford & Metcalfe, 2001) respectively. PCR amplification was carried out using a Cepheid® Smart Cycler II thermocycler and analyzed using Smart Cycler software. The PCR program consisted of an initial denaturation step at 95°C for 15 min, 45 cycles of 15s at 94 ºC, 30 s at 50 °C and 30 s at 72 °C, followed by a final incubation step of 2 min at 72°C. Standard curves based on cDNA dilution series were generated to determine the relative concentrations of amplified viral RNA. Based on 4 replicates, run in two different analyses, a reaction efficiency of around 90% was obtained. Ct values obtained from the PepMV specific assay were standardized by subtraction from an internal control assay (efficiency 99%) amplifying a partial sequence of the ribulose 1.5-biphosphate carboxylase chloroplast gene (Sánchez-Navarro et al. 2005).<br><br>
2011-05-01 | E-MEXP-2389 | biostudies-arrayexpress
Project description:In Saccharomyces cerevisiae, a single double-strand break (DSB) triggers extensive phosphorylation of histone H2A (known as gammaH2AX) over 50 kb on either side of the DSB. This modification is carried out by either of yeastM-^Rs checkpoint kinases, the ATM homolog, Tel1, or the ATR homolog, Mec1. In G1-arrested cells, where there is very little 5M-^R to 3M-^R processing of DSB ends, only Tel1 promotes this modification. We have recently described a second modification gammaH2B - the phosphorylation of the C terminal T129 locus of histone H2B which is also carried out by both Mec1 and Tel1 kinases. To understand in detail how gamma-H2AX and gamma-H2B spread along the chromosome from a DSB we have undertaken a high-density analysis of their occupancy where there is a DSB on three different chromosomes. gamma-H2AX and gamma-H2B modifications are similar, but there is a marked absence of gamma-H2B near telomeres. We find that there is reduced gamma-H2AX and gamma-H2B modification over strongly transcribed regions, even taking into account the reduced histone occupancy of these genes. When transcription of the galactose-regulated genes GAL1, GAL10, GAL7 are turned off by the addition of glucose, gamma-H2AX is restored within 5 min; when these genes are again induced, gamma-H2AX is rapidly lost. Regions more distal to the GAL genes have markedly reduced gamma-H2AX levels that rise rapidly when transcription is repressed, suggesting that transcription acts as a barrier to the propagation of gamma-H2AX away from the DSB. The restoration of gamma-H2AX in transcribed regions can be carried out by either Mec1 or Tel1, even 7 h after break induction, suggesting that Tel1 remains associated with damaged chromosomes for an extended time. In addition, we show that gamma-H2AX can be transferred in trans, to regions unlinked to the DSB that lie in close proximity the DSB. Specifically, if a DSB is generated 14 kb from CEN2, gamma-H2AX is transferred to regions around all the other centromeres, in keeping with observed close proximity of all centromere-adjacent chromosome arms. This transfer can be observed even in the absence of formaldehyde crosslinking of the samples.
2013-12-15 | E-MTAB-1409 | biostudies-arrayexpress
Project description:Salt stress causes the quality change and significant yield loss of tomato. However, the resources of salt-resistant tomato were still deficient and the mechanisms of tomato resistance to salt stress were still unclear. In this study, the proteomic profiles of two salt-tolerant and salt-sensitive tomato cultivars were investigated to deciphered the salt-resistance mechanism of tomato and provide novel resources for tomato breeding. We found that there is an over-abundant proteins relevant to Nitrate and amino acids metabolisms in the Salt-tolerant cultivars. The significant increase in expression of proteins involved in Brassinolides and GABA biosynthesis were verified in salt-tolerant cultivars, strengthening the salt resistance of tomato. Meanwhile, salt-tolerant cultivars with higher abundance and activity of antioxidant-related proteins have more advantages in dealing with reactive oxygen species caused by salt stress. And the salt-tolerant cultivars had higher photosynthetic activity based on overexpression of proteins functioned in chloroplast, guaranteeing the sufficient nutrient for plant growth under salt stress. Furthermore, three key proteins were identified as important salt-resistant resources for breeding salt-tolerant cultivars, including Sterol side chain reductase, gamma aminobutyrate transaminase and Starch synthase. Our results provided series valuable strategies for salt-tolerant cultivars which can be used in future
2022-02-08 | PXD029130 | Pride