Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

RNA-seq of human lung epithelial A549 cells compared to A549 cells with shBMAL1 mediated knockdown of BMAL1 at two circadian phases

ABSTRACT: A549 lung cells were infected with pGIPZ carrying shBMAL1 hairpin. Knockdown was confirmed by Western blot before sequencing experiment. Both parental and knockdown cells lines were then synchronised with forskolin and 12 or 24 hours later triplicates of both cell lines were collected and RNA was extracted with the Quiagen RNAEasy kit. RNA was send to Novogen for library generation and sequencing on a NovaSeq platform with a 150bp paired-ended kit.

INSTRUMENT(S): Illumina NovaSeq 6000

ORGANISM(S): Homo sapiens

SUBMITTER: Robert Dallmann

PROVIDER: E-MTAB-15036 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

The effect of THADA knockdown on Huh7 cells

Project description:We use lentivirus carrying shRNA for THADA to evaluate the efect of THADA knockdown in Huh7 cells. The pGIPZ shRNA plasmid specific to human THADA (clone ID V3LHS_318037 Open Biosystems, Inc.) or the pGIPZ non-silencing shRNAmir lentiviral plasmid (as a control) was cotransfected with the pPACKH1 plasmid mix in HEK 293 cells. Stable clones of Huh7 cells with THADA knockdown were routinely maintained in a medium containing of puromycin (500ng/ml)

2015-08-01 | E-GEOD-65233 | biostudies-arrayexpress

A549 MMAB knockdown

Project description:A549 MMAB knockdown

| PRJEB100796 | ENA

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

Project description:Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.

2019-12-16 | GSE124345 | GEO

Analysis of the senescence transcriptome after knockdown of AHCY

Project description:IMR90 ER:RAS cells were infected with 2 different lentiviral pGIPZ shRNAs against AHCY or with an empty vector (EV). We treated IMR90 ER:RAS cells with 4OHT to induce RAS activation or with vehicle (DMSO) as a non-senescent control. RNA was collected 6 days after the start of the experiment once the senescence program has been fully implemented. Our previous experiments showed that knockdown of AHCY prevents senescence. By performing RNAseq, we have unveiled that AHCY knockdown prevents upregulation of a set of genes essential for the onset of senescence and its associated secretory phenotype.

2022-07-19 | GSE155904 | GEO

Androgen receptor-independent function of FoxA1 in prostate cancer metastasis

Project description:FoxA1 has been shown critical for prostate development and prostate-specific gene expression regulation. In addition to its well-established role as an AR pioneering factor,several studies have recently revealed significant AR binding events in prostate cancer cells with FoxA1 knockdown. Furthermore, the role of FoxA1 itself in prostate cancer has not been carefully examined. Thus, it is important to understand the role of FoxA1 in prostate cancer and how it interacts with AR signaling. To address these questions, we generated engineered LNCaP cells with FoxA1 knockdown using shRNA or siRNA, 22RV1 cells with stable FoxA1 knockdown and PC3M cells with FoxA1 stable overexpression. We performed microarray analysis of these cells. We performed microarray analysis on LNCaP cells with FoxA1 knockdown using shRNA or siRNA, 22RV1 cells with stable FoxA1 knockdown and PC3M cells with FoxA1 stable overexpression

2013-04-05 | E-GEOD-37314 | biostudies-arrayexpress

Circadian Regulation of Protein Cargo in Exosomes

Project description:The circadian clock controls many aspects of physiology, but it remains undescribed whether extracellular vesicles (including exosomes) involved in cell-cell communications between tissues are regulated in a circadian pattern. We demonstrate a 24 h rhythmic abundance of individual proteins in exosomes using liquid chromatography-mass spectrometry in circadian-synchronised tendon fibroblasts. Further, the release of exosomes enriched in RNA-binding proteins was temporally separated from those enriched in cytoskeletal and matrix proteins, which peaked during the end of the light phase. Finally, we targeted the protein sorting mechanism in the exosome biogenesis pathway and established (by knockdown of circadian-regulated flotillin-1) that matrix metalloproteinase 14 abundance in tendon fibroblast exosomes is under flotillin-1 regulation. In conclusion, we have identified proteomic time signatures for exosomes released by tendon fibroblasts which supports the view that the circadian clock regulates protein cargo in exosomes involved in cell-cell crosstalk.

2022-05-19 | PXD022393 | Pride

Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism

Project description:In this study we show that, in embryonic fibroblasts from mice on a high fat diet and treated with Forskolin, ionizing radiation exposure or both, phosphorylation of CREB-binding protein (CREB) by ATM (ataxia-telangiectasia-mutated) and casein kinases 1 and 2 (CK1 and CK2) on a cluster of five phosphorylation sites (the ATM/CK cluster) within the unstructured kinase-inducible domain (KID) provides an additional level of regulation through dynamic modulation of CREB DNA binding activity. Stoichiometric phosphorylation of the ATM/CK cluster in response to DNA damage inhibited cAMP-induced CREB target gene expression, CREB DNA binding activity, and CREB-CRTC2-DNA ternary complex formation proportional to the number of phosphate residues modified. Substoichiometric phosphorylation of the ATM/CK cluster promoted cAMP/Ca2+-regulated transcriptional coactivators (CRTCs) recruitment and CREB activation via an ATM-independent, PKA-dependent pathway. Mice expressing a non-phosphorylatable CREBS111A allele exhibited phenotypes consistent with CREB deregulation, including fasting hyperglycemia, susceptibility to diet-induced obesity, and reduced expression of gluconeogenic genes. Two genotypes: CREB+/+ (wild type) and CREBS111A (non-phosphorylatable CREB KID S111A mutant allele) each control treated, exposed to forskolin, ionizing radiation or both in triplicate and in two batches toataling 48 arrays

2016-07-01 | E-GEOD-83891 | biostudies-arrayexpress

mRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines

Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress

PRRX1 Orchestrates Pericyte-Myofibroblast Transition in Pathological Retinal Fibrosis

Project description:This study investigates the role of PRRX1 in the pericyte-myofibroblast transition and its contribution to retinal fibrosis. Mouse retinal microvascular pericytes (Pricella Biotechnology, CP-M315) were cultured under hypoxic conditions (1% O2, 24 hours) with or without Prrx1 knockdown. Total RNA was extracted from 7 samples (3 control, 4 Prrx1 knockdown), sequenced on an Illumina NovaSeq 6000 platform with 150bp paired-end reads, and processed to quantify gene expression as raw counts.

2025-12-04 | GSE303180 | GEO

Homo sapiens strain:A549

Project description:Homo sapiens Transcriptome: MGLL knockdown in A549 cell line

| PRJNA606389 | ENA