Comparative evaluation of Oxford Nanopore Technologies’ adaptive sampling and the Twist long-read PGx panel for pharmacogenomic profiling
Ontology highlight
ABSTRACT:
INSTRUMENT(S): PromethION
ORGANISM(S): Homo sapiens
SUBMITTER: Koen Deserranno
PROVIDER: E-MTAB-15248 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:Ewes were maintained on pastures fertilised with either inorganic fertiliser (control) or biosolids for at least 1 month prior to mating by AI. After birth all animals were maintained on control pastures. at 8-weeks of age male offspring were euthanised and testes analysed by direct cDNA nanopore sequencing.
2022-04-24 | E-MTAB-11645 | biostudies-arrayexpress
Project description:To evaluate targeted MinION next generation sequencing as a diagnostic method for detection of pathogens in human blood and plasma, human blood or plasma samples were spiked with measured amounts of viruses, bacteria, protozoan parasites or tested pathogen-free as negative controls. Nucleic acid was extracted from samples and PCR amplification performed in multiplex primer pools with a procedure described in ArrayExpress experiment submission ID 18379. The PCR products were used for library preparation. The libraries sequenced on an Oxford Nanopore MinION. The passed reads aligned with a custom reference file to determine the identity of the pathogen in the sample.
2024-06-08 | E-MTAB-14011 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion (t8) and intergenic region deletion (i50) clones in HepG2 . By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-11327 | biostudies-arrayexpress
Project description:This dataset contains Xdrop followed by oxford nanopore long read sequencing performed in target tRNA gene deletion clones in HAP1 (t72) and HepG2 (t15). By applying de novo assembly based approach to Xdrop-LRS data, we identified Cas9-induced on-target genomic alteration.
2022-09-16 | E-MTAB-10652 | biostudies-arrayexpress
Project description:Using long-read nanopore sequencing, we obtained chromosome-wide phased methylomes of the active and inactive X in mouse placenta and neural stem cells (NSCs), overcoming the limitations if short-read bisulfite sequencing in allelic resolution. We also conducted quantitative analysis of methylation properties like symmetry and entropy, providing a more comprehensive view of epigenetic silencing in X chromosome inactivation. We also resolved the allele-specific genetics and epigenetics of structural macrosatellite Dxz4 and other repeats.
2024-03-12 | E-MTAB-13706 | biostudies-arrayexpress
Project description:EATRO1125 bloodstream forms grown to about 5 x 10e5 per ml. Lister 427 procyclic forms at no more than 2 million per ml. Direct nanopore sequencing on cells approaching their expiration date.
2020-07-16 | E-MTAB-9319 | biostudies-arrayexpress
Project description:The zinc finger antiviral protein (ZAP, also known as PARP13 or ZC3HAV1) is an antiviral factor that restricts the replication of a wide range of RNA and DNA viruses. It exerts its antiviral function primarily by binding specific sequences known as ZAP response elements (ZREs) within single-stranded RNA, promoting RNA degradation or inhibiting its translation. The ZAP RNA-binding domain shows a high affinity for binding to CpG dinucleotides, which are generally depleted in vertebrate RNA viruses. There are two major isoforms of ZAP, the long isoform (ZAP-L) and the short isoform (ZAP-S). ZAP has no enzymatic activity and requires cofactors to effectively restrict viral replication. We aimed to characterise the mechanisms underlying ZAP-mediated RNA decay and, in particular, to investigate how ZAP cofactors influence its binding to viral RNA and subsequent RNA degradation. We used an HIV-1 model that was sensitised to ZAP activity by introducing 36 additional CpG dinucleotides through silent mutations into the env gene. The role of ZAP cofactors TRIM25 and KHNYN as well as the ZAP-L and ZAP-S isoforms was investigated by CRISPR-mediated depletion. ZAP interactions with viral RNA was analysed using iCLIP assays performed in TRIM25, KHNYN, ZAP-L and ZAP-S knockout cell lines. In addition, we used 3′ and 5′ RACE-seq in combination with Oxford Nanopore Technologies sequencing technology to accurately identify KHNYN-mediated cleavage sites on viral RNA.
2025-09-30 | E-MTAB-15097 | biostudies-arrayexpress
Project description:The zinc finger antiviral protein (ZAP, also known as PARP13 or ZC3HAV1) is an antiviral factor that restricts the replication of a wide range of RNA and DNA viruses. It exerts its antiviral function primarily by binding specific sequences known as ZAP response elements (ZREs) within single-stranded RNA, promoting RNA degradation or inhibiting its translation. The ZAP RNA-binding domain shows a high affinity for binding to CpG dinucleotides, which are generally depleted in vertebrate RNA viruses. There are two major isoforms of ZAP, the long isoform (ZAP-L) and the short isoform (ZAP-S). ZAP has no enzymatic activity and requires cofactors to effectively restrict viral replication. We aimed to characterise the mechanisms underlying ZAP-mediated RNA decay and, in particular, to investigate how ZAP cofactors influence its binding to viral RNA and subsequent RNA degradation. We used an HIV-1 model that was sensitised to ZAP activity by introducing 36 additional CpG dinucleotides through silent mutations into the env gene. The role of ZAP cofactors TRIM25 and KHNYN as well as the ZAP-L and ZAP-S isoforms was investigated by CRISPR-mediated depletion. ZAP interactions with viral RNA was analysed using iCLIP assays performed in TRIM25, KHNYN, ZAP-L and ZAP-S knockout cell lines. In addition, we used 3′ and 5′ RACE-seq in combination with Oxford Nanopore Technologies sequencing technology to accurately identify KHNYN-mediated cleavage sites on viral RNA.
2025-09-30 | E-MTAB-15095 | biostudies-arrayexpress
Project description:The zinc finger antiviral protein (ZAP, also known as PARP13 or ZC3HAV1) is an antiviral factor that restricts the replication of a wide range of RNA and DNA viruses. It exerts its antiviral function primarily by binding specific sequences known as ZAP response elements (ZREs) within single-stranded RNA, promoting RNA degradation or inhibiting its translation. The ZAP RNA-binding domain shows a high affinity for binding to CpG dinucleotides, which are generally depleted in vertebrate RNA viruses. There are two major isoforms of ZAP, the long isoform (ZAP-L) and the short isoform (ZAP-S). ZAP has no enzymatic activity and requires cofactors to effectively restrict viral replication. We aimed to characterise the mechanisms underlying ZAP-mediated RNA decay and, in particular, to investigate how ZAP cofactors influence its binding to viral RNA and subsequent RNA degradation. We used an HIV-1 model that was sensitised to ZAP activity by introducing 36 additional CpG dinucleotides through silent mutations into the env gene. The role of ZAP cofactors TRIM25 and KHNYN as well as the ZAP-L and ZAP-S isoforms was investigated by CRISPR-mediated depletion. ZAP interactions with viral RNA was analysed using iCLIP assays performed in TRIM25, KHNYN, ZAP-L and ZAP-S knockout cell lines. In addition, we used 3′ and 5′ RACE-seq in combination with Oxford Nanopore Technologies sequencing technology to accurately identify KHNYN-mediated cleavage sites on viral RNA.
2025-09-30 | E-MTAB-15064 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress