Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Molecular insights into DDX3X–mRNA regulation in castration-resistant prostate cancer

ABSTRACT: RNA-immunoprecipitation sequencing (RIP-seq) was performed to identify the transcripts under the regulation of DEAD-box helicase 3 X-linked (DDX3X). The BPH1-derived Cancer Progression (BCaP) cell lines were used for RIP-seq. Input and RIP RNA from the androgen receptor low/negative castration-resistant prostate cancer (ARL/- CRPC) BCaPMT10 and non-tumorigenic BCaPNT1 cells were extracted using the RNease Mini Kit. Libraries were prepared using the KAPA RNA HyperPrep Kit and sequenced on an Illumina HiSeq 2500 platform.

INSTRUMENT(S): Illumina HiSeq 2500, n/a, KAPA RNA HyperPrep Kit, RNeasy Mini Kit

ORGANISM(S): Homo sapiens

SUBMITTER: Han Zhang

PROVIDER: E-MTAB-15800 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

DDX3X SUMOylation Promotes Septic Inflammation by Enhancing NLRP3 Inflammasome Activation

Project description:This study investigates the role of DDX3X SUMOylation in the activation of the NLRP3 inflammasome during sepsis. We demonstrate that SUMOylation of DDX3X, regulated by the SUMO protease SENP1, is a crucial trigger for NLRP3 inflammasome activation. In endotoxemia and sepsis models, the absence of SENP1 in macrophages and mice led to increased NLRP3 inflammasome activation. Mechanistically, DDX3X SUMOylation promoted the interaction of NLRP3 at lysine 118, inhibiting K48-conjugated ubiquitination and subsequent degradation of NLRP3 by the deubiquitinase OTUD6A, resulting in enhanced oligomerization of NLRP3. In murine adoptive transfer experiments, macrophages expressing the SUMOylation-inhibiting mutation DDX3X-K118R suppressed NLRP3 inflammasome activation, providing protection against LPS-induced inflammatory lung injury. These findings suggest that SENP1-mediated DDX3X deSUMOylation regulates NLRP3 inflammasome activation, offering a potential therapeutic avenue to mitigate NLRP3-induced inflammation.

2025-03-06 | PXD060598 | Pride

Ubiquitination of DEAD-box RNA helicase DDX3X by TRIM25

Project description:Tripartite motif protein 25 (TRIM25) is an E3 ligase that ubiquitinates multiple substrates within the RLR signalling cascade and plays both RING (really interesting new gene)-dependent and RING-independent roles in RIG-I-mediated IFN induction. We report that the PRY-SPRY domain of TRIM25 interacts with the N-terminal extension (NTE) of DEAD-box helicase 3X (DDX3X), a host protein with multiple roles in RLR signalling. Gene reporter assays and knockdown studies reveal DDX3X and TRIM25 cooperate to activate the IFN- promoter following RIG-I activation independent of DDX3X’s catalytic activity. We also show that TRIM25 ubiquitinates DDX3X at several lysine residues in vitro and in cells.

2021-09-08 | PXD028122 | Pride

DDX3X associated proteins with or without circRIG-I

Project description:We use FLAG pulldown assay to find DDX3X associated proteins with or without circRIG-I in HEK293T.

2022-11-16 | PXD037929 | Pride

iCLIP of DDX3X and DDX54 in human breast cancer MCF7 cells

Project description:Individual nucleotide resolution cross-linking immunoprecipitation (iCLIP) detects protein-RNA binding sites at a single nucleotide resolution. We aimed to identify the transcripts directly bound to DDX3X and DDX54 in human breast cancer MCF7 cells and to characterize the site of interaction at a single nucleotide resolution.

2018-11-21 | E-MTAB-6230 | biostudies-arrayexpress

RNA-seq expression profiling of OCI-AML2 and OCI-AML3 cells upon CRISPR/Cas9 –mediated disruption of DDX3X RNA binding domain

Project description:Human acute myeloid leukemia cell lines OCI-AML2 and OCI-AML3 were used in a CRISPR/Cas9-mediated approach to specifically target DDX3X’s gene sequences encoding the RNA binding domain of the helicase. DDX3X RNA binding domain is bipartite in the two halves of the helicase core. sgRNAs were designed to target both halves of the domain (named RNA binding domain A and B – RBDA and RBDB). We performed RNA-seq to observe the gene expression changes in both OCI-AML2 and OCI-AML3 cell lines following the not-combined CRISPR/Cas9 –mediated targeting of both regions of the DDX3X RNA binding domain. Control CRISPR/Cas9 performed with no sgRNA expressing vector (named “empty vector”) was performed in both cell lines. The latter condition was used as a control for gene expression changes analysis, for each cell line.

2019-11-23 | E-MTAB-6241 | biostudies-arrayexpress

Expression profiling of DDX3X and DDX54 knockdown in MCF7 cells

Project description:We performed RNA-seq to observe the gene expression changes in cells following siRNA-mediated knockdown of DDX3X and DDX54 RNA helicases in human breast cancer MCF7 cells. Two siRNAs were used to target each RNA helicase and scramble siRNA-treated MCF7 cells were used as controls.

2018-11-21 | E-MTAB-6235 | biostudies-arrayexpress

Medulloblastoma associated DDX3X mutants restore malignant potential of medulloblastoma cells decreased upon the loss of DDX3X expression

Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.

2023-03-31 | GSE201967 | GEO

Sexually dimorphic RNA helicases DDX3X and DDX3Y differentially regulate hollow condensates of DDX3X disease variants

Project description:The sex chromosome-encoded RNA helicases DDX3X and DDX3Y play important roles in RNA metabolism. Heterozygous mutations of DDX3X frequently occur in cancers and neurodevelopmental disorders which have strong sex biases. However, how different DDX3X variants impair cellular function in sex specific genetic background is not understood. Herein, we found that DDX3X variants with significantly impaired ATPase activities demixed into the shells of unique hollow condensates, the dynamics of which were further differentiated by the RNA binding affinities of the different DDX3X variants. Proteomic and imaging studies revealed that DDX3X variant condensates sequestered wild-type DDX3X, DDX3Y, and other proteins important for various signaling pathways. Intriguingly, wild-type DDX3X improved the dynamics of heterogenous variant/wild-type hollow condensates more than DDX3Y. These results suggest that DDX3X variants with distinct enzymatic and condensation propensities may interact uniquely with wild-type DDX3X or DDX3Y to cause sex-specific cellular impacts.

2022-11-26 | MSV000090789 | MassIVE

Transcriptome profiling of DDX3X/DDX3Y dependency after DDX3X gRNA targeting in KNS-42 parental cell lines, and rescue experiments with DDX3X or DDX3Y overexpressing cells (PACT).

Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.

2022-04-06 | GSE190507 | GEO

DDX3X regulation of global translation is impaired by medulloblastoma-associated mutations [RiboSeq]

Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.

2016-05-20 | GSE59095 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data