Whole genome sequencing of spontaneous resistant mutants of Mycobacterium tuberculosis H37Rv selectec in the presence of BVL3572S and amino acids
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq X
ORGANISM(S): Mycobacterium tuberculosis
SUBMITTER: Zainab Edoo
PROVIDER: E-MTAB-17255 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:(i) RNA-seq of M. tuberculosis H37Rv cultures grown in the presence of BVL3572S for 6 h compared to untreated controls. (ii) Genome-wide M. tuberculosis H37Rv CRISPRi libraries were grown in the presence of ATc for 5 days prior to drug exposure. Cultures were treated with sub-MIC BVL3572S concentrations without amino acid or in the presence of L-His, L-Ala, or both. After 14 days outgrowth, genomic DNA were harvested from cultures for which BVL3572S concentrations were partially growth inhibitory and from untreated controls. Abundance of sgRNA was analyzed by deep sequencing. (iii) Genome-wide M. tuberculosis H37Rv transposon mutant librairies were treated with BVL3572S or untreated for 15 days followed by a 7-day antibiotic-free outgrowth. Genomic DNA were extracted, indexed, and sequenced.
2026-04-20 | E-MTAB-16773 | biostudies-arrayexpress
Project description:The mycobacterial IdeR protein is a metal-dependent regulator of the DtxR (diphtheria toxin repressor) family. In the presence of iron, it binds to a specific DNA sequence in the promoter regions of the genes that it regulates, thus controlling their transcription. In this study, we provide evidence that ideR is an essential gene in Mycobacterium tuberculosis. ideR cannot normally be disrupted in this mycobacterium in the absence of a second functional copy of the gene. However, a rare ideR mutant was obtained in which the lethal effects of ideR inactivation were alleviated by a second-site suppressor mutation and which exhibited restricted iron assimilation capacity. Studies of this strain and a derivative in which IdeR expression was restored allowed us to identify phenotypic effects resulting from ideR inactivation. Using DNA microarrays, the iron-dependent transcriptional profiles of the wild-type, ideR mutant, and ideR complemented mutant strains were analyzed, and the genes regulated by iron and IdeR were identified. These genes encode a variety of proteins, including putative transporters, proteins involved in siderophore synthesis and iron storage, members of the PE/PPE family, a membrane protein involved in virulence, transcriptional regulators, and enzymes involved in lipid metabolism. Keywords: strain or line design, genetic modification design, comparative genome hybridization design and stimulus or stress design 18 samples were analyzed. The quality controls were biological replicate and technical replicate
2007-08-08 | E-GEOD-8732 | biostudies-arrayexpress
Project description:The mycobacterial IdeR protein is a metal-dependent regulator of the DtxR (diphtheria toxin repressor) family. In the presence of iron, it binds to a specific DNA sequence in the promoter regions of the genes that it regulates, thus controlling their transcription. In this study, we provide evidence that ideR is an essential gene in Mycobacterium tuberculosis. ideR cannot normally be disrupted in this mycobacterium in the absence of a second functional copy of the gene. However, a rare ideR mutant was obtained in which the lethal effects of ideR inactivation were alleviated by a second-site suppressor mutation and which exhibited restricted iron assimilation capacity. Studies of this strain and a derivative in which IdeR expression was restored allowed us to identify phenotypic effects resulting from ideR inactivation. Using DNA microarrays, the iron-dependent transcriptional profiles of the wild-type, ideR mutant, and ideR complemented mutant strains were analyzed, and the genes regulated by iron and IdeR were identified. These genes encode a variety of proteins, including putative transporters, proteins involved in siderophore synthesis and iron storage, members of the PE/PPE family, a membrane protein involved in virulence, transcriptional regulators, and enzymes involved in lipid metabolism.
2007-09-12 | E-TABM-317 | biostudies-arrayexpress
Project description:Log phase cultures (OD600 of 0.8 - 1.0) of M. smegmatis mc2155 were diluted 1:100 into 7H9 media and cultured for approximately 12 hours until the OD600 reached 0.3. Re-inoculated cells were then treated with the indicated concentrations of H2O2 (0.2 and 7 mM) for periods of 30 min and the corresponding total RNAs were isolated and compared by RNA-sequencing to RNA from untreated cells that were prepared simultaneously.
2015-12-22 | E-MTAB-3594 | biostudies-arrayexpress
Project description:Accurate predictions of the DNA binding specificities of transcription factors (TFs) are necessary for understanding gene regulatory mechanisms. Traditionally, predictive models are built based on nucleotide sequence features. Here, we employed three- dimensional DNA shape information obtained on a high-throughput basis to integrate intuitive DNA structural features into the modeling of TF binding specificities using support vector regression. We performed quantitative predictions of DNA binding specificities, using the DREAM5 dataset for 65 mouse TFs and genomic-context protein binding microarray data for three human basic helix-loop-helix TFs. DNA shape-augmented models compared favorably with sequence-based models for these predictions. Although both k-mer and DNA shape features encoded the interdependencies between nucleotide positions of the binding site, using DNA shape features reduced the dimensionality of the feature space compared to k-mer use. Finally, analyzing the weights of DNA shape-augmented models uncovered TF family- specific structural readout mechanisms that were not obvious from the nucleotide sequence. Three genomic-context protein binding microarray (gcPBM) experiments of human transcription factors were performed. Briefly, the gcPBMs involved binding his-tagged transcription factors c-Myc, Max, and Mad1(Mxd1) to double-stranded 180K Agilent microarrays in order to determine their binding specificity for putative DNA binding sites in native genomic context. Briefly, we represent three categories of 36-bp sequences: 1) bound probes, 2) unbound probes (or negative controls), and 3) test probes. Bound probes corresponded to genomic regions bound in vivo by c-Myc, Max, or Mad2 (ChIP-seq P < 10^(-10) in HeLaS3 or K562 celld (ENCODE)) that contain at least two consecutive 8-mers with universal PBM E-score > 0.4 (Munteanu and Gordan, LNCS 2013). All putative binding sites occur at the same position within the probes on the array. M-bM-^@M-^\UnboundM-bM-^@M-^] probes corresponded to genomic regions with ChIP-seq P < 10^(-10) and a maximum 8-mer E-score < 0.2. We also designed test probes that contain, within constant flanking regions, all nnCACGTGnn 10-mers and 18 nnnCACGTGnnn 12-mers (where n = A, C, G, or T). Each DNA sequence represented on the array is present in 6 replicate spots. We report the gcPBM signal intensity for each spot. The PBM protocol is described in Berger et al., Nature Biotechnology 2006 (PMID 16998473).
2014-11-04 | E-GEOD-59845 | biostudies-arrayexpress
Project description:Until now, it has been reasonably assumed that specific base-pair recognition is the only mechanism controlling the specificity of transcription factor (TF)M-bM-^HM-^RDNA binding. Contrary to this assumption, here we show that nonspecific DNA sequences possessing certain repeat symmetries, when present outside of specific TF binding sites (TFBSs), statistically control TFM-bM-^HM-^RDNA binding preferences. We used high-throughput proteinM-bM-^HM-^RDNA binding assays to measure the binding levels and free energies of binding for several human TFs to tens of thousands of short DNA sequences with varying re- peat symmetries. Based on statistical mechanics modeling, we iden- tify a new proteinM-bM-^HM-^RDNA binding mechanism induced by DNA se- quence symmetry in the absence of specific base-pair recognition, and experimentally demonstrate that this mechanism indeed gov- erns proteinM-bM-^HM-^RDNA binding preferences. Four custom protein binding microarray (PBM) experiments of human transcription factors were performed. Briefly, the PBMs involved binding his-tagged transcription factors c-Myc, Max, and Mad1(Mxd1) to double-stranded 180K Agilent microarrays in order to determine their binding specificity for GTCACGTGAC DNA binding sites flanked by repetitive DNA elements with different symmetries and correlation length scales. Briefly, we represent three categories of 36-bp sequences: 1) 28800 probes centered at a GTCACGTGAC site and flanked by repetitive elements (probe names starting with Ariel_); 2) Unbound probes (or negative controls); and 3) Bound probes, which correspond to randomly selected genomic regions bound in vivo by c-Myc, Max, or Mad2 (ChIP-seq P < 10^(-10) in HeLaS3 or K562 celld (ENCODE)), which contain at least two consecutive 8-mers with universal PBM E-score > 0.4 (Munteanu and Gordan, LNCS 2013). Each DNA sequence represented on the array is present in 6 replicate spots. We report the gcPBM signal intensity for each spot (raw files) as well as the median intensity over the 6 replicate spots (normalized data). The PBM protocol is described in Berger et al., Nature Biotechnology 2006 (PMID 16998473).
2014-10-01 | E-GEOD-61920 | biostudies-arrayexpress
Project description:Identification of the mechanisms of action of the drugs at the genomic level.
2022-12-31 | E-MTAB-12307 | biostudies-arrayexpress
Project description:Treatment of stationary growth phase Staphylococcus aureus SA113 with 100-fold of the MIC of the lipopeptide antibiotic daptomycin leaves alive a small fraction of drug tolerant albeit genetically susceptible bacteria. This study shows that cells of this subpopulation exhibit active metabolism even hours after the onset of the drug challenge. Isotopologue profiling using fully 13C-labeled glucose revealed de novo biosynthesis of the amino acids Ala, Asp, Glu, Ser, Gly and His. The isotopologue composition in Asp and Glu suggested an increased activity of the TCA cycle under daptomycin treatment compared to unaffected stationary growth phase cells. Microarray analysis showed differential expression of specific genes 10 minutes and 3 hours after addition of the drug. Besides factors involved in drug response, a number of metabolic genes appear to shape the signature of daptomycin-tolerant S. aureus cells. These observations will be useful towards the development of new strategies against persisters and related forms of bacterial cells with downshifted physiology. Altogether 12 samples were analysed. Bacteria were treated with Daptomycin and samples were taken 10 minutes (3 replicates) and 3 hours later (3 replicates). For each time-point untreated cultures were sampled as controls (3 replicates for each time-point).
2014-06-06 | E-GEOD-57908 | biostudies-arrayexpress
Project description:The SELEX-seq platform was used to generate DNA-binding affinity predictions for the human Max transcription factor. This experiment was performed as part of a cross-validation study comparing the accuracy of DNA shape-augmented TF binding specificity models across two different platforms (SELEX-seq and gcPBM) Two rounds of SELEX were performed on Max protein as described in Slattery et al, Cell, 2011 (PMID 22153072). Briefly, His-tagged Max was incubated with a randomized 16mer oligonucleotide library (GTTCAGAGTTCTACAGTCCGACGATCTGG[ACGT]{16}CCAGAACTCGTATGCCGTCTTCTGCTTG). Max bound DNA was amplified and sequenced as described (Slattery et al, 2011).
2015-03-01 | E-GEOD-60200 | biostudies-arrayexpress
Project description:The breast milk plays a crucial role in shaping the initial intestinal microbiota and mucosal immunity of the infant. Interestingly, breastfeeding has proven to be protective against the early onset of immune-mediated diseases including type 1 diabetes (T1D). Studies have shown that exosomes from human breast milk (HM) are enriched in immune-modulating miRNAs suggesting that exosomal miRNAs transferred to the infant could play a critical role in the development of the infant’s immune system. In this study, we extracted exosome exosomal microRNAs (exomiRs) from breast milk of type 1 diabetic and healthy lactating mothers, in order to identify any differences in the exomiR content between the two groups
2019-08-01 | E-MTAB-7336 | biostudies-arrayexpress