Gambiae_RNAseq
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina HiSeq 2000
ORGANISM(S): Anopheles gambiae
SUBMITTER: Adrien Pain
PROVIDER: E-MTAB-2595 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.
2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress
Project description:small RNA deep seq responses of Anopheles gambiae 3 days post arbovirus infection by artificial blood feeding
2018-06-28 | E-MTAB-6444 | biostudies-arrayexpress
Project description:Background. The mosquito, Anopheles gambiae, is the primary vector of human malaria, a disease responsible for millions of deaths each year. To improve strategies for controlling transmission of the causative parasite, Plasmodium falciparum, we require a thorough understanding of the developmental mechanisms, physiological processes and evolutionary pressures affecting life-history traits in the mosquito. Identifying genes expressed in particular tissues or involved in specific biological processes is an essential part of this process. Results. In this study, we present transcription profiles for ~82% of annotated Anopheles genes in dissected adult male and female tissues. The sensitivity afforded by examining dissected tissues found gene activity in an additional 20% of the genome that is undetected when using whole-animal samples. The somatic and reproductive tissues we examined each displayed patterns of sexually dimorphic and tissue-specific expression. By comparing expression profiles with Drosophila melanogaster we also assessed which genes are well conserved within the Diptera versus those that are more recently evolved. Conclusions. Our expression atlas and associated publicly available database, the MozAtlas (www.tissue-atlas.org), provides information on the relative strength and specificity of gene expression in several somatic and reproductive tissues, isolated from a single strain grown under uniform conditions. The data will serve as a reference for other mosquito researchers by providing a simple method for identifying where genes are expressed in the adult, however, in addition our resource will also provide insights into the evolutionary diversity associated with gene expression levels among species. MozAtlas is composed of data covering 15 distinct adult tissues with 4 replicates using Affymetrix chips. To provide other researchers with the ability to compare their own experiments with our analyses, we have constructed a database and web-browser for querying tissue expression in Anopheles. This framework will in the future be expanded to include additional tissues and developmental stages, as well as additional species when available.
2011-05-16 | E-GEOD-21689 | biostudies-arrayexpress
Project description:Toll pathway is a key mediator of antiplasmodial immunity and its mechanism of action is dependent on hemocytes (mosquito white blood cells). Anopheles gambiae were injected with dsRNA for Cactus, an inhibitor of the Toll pathway. Cactus silencing over activates the Toll pathway. The goal of this experiment is to evaluate hemocyte transcriptional changes between control mosquitoes injected with a non-related dsRNA (dsLacZ and dsCactus injected mosquitoes. We also divide hemocytes from control and experimental conditions into 2 groups: bound (hemocytes that attach to glass - granulocyte populations) and unbound (hemocytes that remain in suspension - prohemocytes and oenocytoids). Files from Unbound fractions are labelled: UB and from bound fractions are labelled B. Some of the samples were run twice and have 2 gz files.
2021-12-16 | E-MTAB-11252 | biostudies-arrayexpress
Project description:Anopheles gambiae, the primary African malarial mosquito, exhibits numerous behaviors that are under diel and circadian control, including locomotor activity, swarming, mating, host seeking, eclosion, egg laying and sugar feeding. However, little has been performed to elucidate the molecular basis for these daily rhythms. To study how gene expression is globally regulated by diel and circadian mechanisms, we have undertaken a DNA microarray analysis of A. gambiae head and bodies under 12:12 light:dark cycle (LD) and constant dark (DD, free-running) conditions. Zeitgeber Time (ZT) with ZT12 defined as time of lights OFF under the light:dark cycle, and ZT0 defined as end of the dawn transition. Circadian Time (CT) with CT0 defined as subjective dawn, inferred from ZT0 of the previous light:dark cycle. Adult mated but non-blood fed female mosquito heads and bodies under 12:12 light:dark cycle (LD) and constant dark (DD) conditions were collected every 4 hr to generate 48 hr gene expression profiles, and samples were processed with Affymetrix full genome microarrays. Downstream analysis identified genes with ~24hr rhythmic expression profiles.
2011-06-29 | E-GEOD-22585 | biostudies-arrayexpress
Project description:Identification of genes associated with bendiocarb resistance. Mosquitoes collected as larvae from Nagongera and Kihihi, Uganda. Bendiocarb-resistant and unexposed female mosquitoes selected using standard WHO tube bioassays. RNA was extracted from pools of five individuals identified as An. gambiae s.s. Insecticide-susceptible mosquitoes from the Kisumu strain were included as controls. RNA hybridized in an interwoven loop design to compare four biological replicates each of resistant, unexposed, and laboratory mosquitoes.
2018-03-28 | E-MTAB-6280 | biostudies-arrayexpress
Project description:RNA deep seq responses of Anopheles gambiae 3 days post arbovirus infection by artificial blood feeding
2018-06-28 | E-MTAB-6443 | biostudies-arrayexpress
Project description:We provide a broad overview of sequence diversity in An. gambiae mature microRNAs, including annotation of novel microRNAs identified in this study. Non-coding RNA profiling by high throughput sequencing, in duplicate, using Illumina GAIIx.
2014-08-13 | E-GEOD-50396 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:We aimed at identifying the genes regulated by wounding in Anopheles gambiae. Gene expression was compared between wounded and non-wounded mosquitoes, 3h after wounding. Wounding was induced by the injection of dsLacZ using a thin glass needle.
2013-06-05 | E-MEXP-3677 | biostudies-arrayexpress