Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

6 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Interactions of CAF1-NOT complex components from Trypanosoma brucei

ABSTRACT: Our trypanosome yeast two-hybrid prey library was made by random shotgun genomic cloning. NOT2, NOT10, NOT11 and CAF40 were used as baits to screen the library by mating. Diploid progeny were subjected to selection, resulting in between 100 and 800 surviving colonies, from which inserts were amplified and subjected to high-throughput sequencing. This is a Multiplex Library identified using the following primers: >CZ5468-Not1 CTCTACCCATCGAGCTCGAGCTACGTCAACG >CZ5472-ZC3H38 TCGGGACATCGAGCTCGAGCTACGTCAACG >CZ5473-Tb927_7_2780 GAATGAATCGAGCTCGAGCTACGTCAACG >CZ5474-Not11 TGACATCCATCGAGCTCGAGCTACGTCAACG. Yeast 2-hybrid Interactions for NOT10 (Tb927.10.8720), NOT11 (Tb927.8.1960), XAC1 (Tb927.7.2780) and ZC3H38 (Tb927.10.12800)

INSTRUMENT(S): Illumina HiSeq 2000

ORGANISM(S): Trypanosoma brucei

SUBMITTER: Christine Clayton

PROVIDER: E-MTAB-4946 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Target discrimination in nonsense-mediated mRNA decay requires Upf1 ATPase activity (RIP-Seq)

Project description:RNA quality control pathways serve to get rid of faulty RNAs and therefore must be able to discriminate these RNAs from those that are normal. Here we present evidence that the ATPase cycle of SF1 Helicase Upf1 is required for mRNA discrimination during Nonsense-Mediated Decay (NMD). Mutations affecting the Upf1 ATPase cycle disrupt the mRNA selectivity of Upf1, leading to indiscriminate accumulation of NMD complexes on both NMD target and non-target mRNAs. In addition, two modulators of NMD - translation and termination codon-proximal poly(A) binding protein - depend on Upf1 ATPase to limit Upf1-non-target association. Preferential ATPase-dependent dissociation of Upf1 from non-target mRNAs in vitro suggests that selective release of Upf1 contributes to the ATPase-dependence of Upf1 target discrimination. Given the prevalence of helicases in RNA regulation, ATP hydrolysis may be an underappreciated, yet widely employed, activity in target RNA discrimination. CLIP and RIP-seq against Wild Type and Mutant Upf1 in HEK293-T cell lines

2015-07-06 | E-GEOD-69585 | biostudies-arrayexpress

Parkinson's disease genes VPS35 and EIF4G1 interact genetically and converge on alpha-synuclein

Project description:Parkinson's disease (PD) is a common human neurodegenerative movement disorder. Studies of the genetic forms of PD have helped to reveal disease mechanisms. Functional interactions between some Parkinson's disease (PD) genes, like PINK1 and parkin, have been identified, but whether other ones interact remains elusive. Here we report an unexpected genetic interaction between two PD genes, VPS35 and EIF4G1. We provide evidence that EIF4G1 upregulation causes defects associated with protein misfolding. Expression of a sortilin protein rescues these defects, downstream of VPS35, suggesting a potential role for sortilins in PD. We also show interactions between VPS35, EIF4G1 and alpha-synuclein, a protein with a key role in the pathogenesis of both sporadic and familial PD. We extend our findings from yeast to an animal model and show these interactions are conserved in neurons. We also connect VPS35 impairments to neurodegeneration in alpha-synuclein transgenic mice. Our studies reveal unexpected genetic and functional interactions between two seemingly unrelated PD genes and functionally connect them to alpha-synuclein pathobiology in yeast, worms, and mouse. Finally, we provide a resource of candidate PD genes for future genetic and functional interrogation. Ribosome profiling (RiboSeq) of wild type and VPS35 deletion yeast strains, with or without overexpression of the TIF4631 initiation factor

2014-12-19 | E-GEOD-64304 | biostudies-arrayexpress

Identification of protein-RNA interactions in Drosophila using RIP-Seq

Project description:The goal of these experiments is to identify RNAs bound by individual RNA-binding proteins. Drosophila S2R+ cells were transiently transfected with vectors encoding the indicated HA-tagged RNA-binding proteins, or without an insert as a control. Expression was induced with CuSO4, whole cell lysates were prepared and protein-RNA complexes were isolated by immunoprecipitation with HA immunoaffinity resin. RNA was then isolated from the immunoprecipitated material, and RNA-Seq libraries were prepared and sequenced. Sequence reads were aligned to the D. melanogaster reference genome Dm3 using TopHat and expression levels were quantitated using cufflinks. This work was funded as part of the modENCODE project by NHGRI. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf At least two biological replicates were performed for each protein studied. In addition, control experiments were performed in which cells were transfected with the same vector lacking an open reading frame.

2012-05-05 | E-GEOD-37756 | biostudies-arrayexpress

Analysis of innate immune antagonism by SARS-CoV-2 reveals options for therapeutic immune modulation and differences to SARS-CoV

Project description:The novel coronavirus SARS-CoV-2 has rapidly caused a global pandemic, due to higher transmission rates and lower mortality than previous epidemic CoVs. Here, we systematically analysed changes in the proteome of HEK293 cells upon overexpression of key SARS-CoV-2 encoded proteins and compared them to changes upon SARS-CoV-2 infection.

2021-06-23 | PXD021899 | Pride

Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish (Run6)

Project description:Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish. Each loci has a control, where no Cas9/sgRNA were injected. This is amplicon sequencing with Illumina, after PCR amplification. Data was processed with ampliCan R package version 1.1.1.

2017-12-25 | E-MTAB-6310 | biostudies-arrayexpress

Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish (Run 9)

2017-12-15 | E-MTAB-6357 | biostudies-arrayexpress

Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish (Run 10)

2017-12-15 | E-MTAB-6358 | biostudies-arrayexpress

Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish (Run 8)

2017-12-15 | E-MTAB-6356 | biostudies-arrayexpress

Analysis of Cas9/sgRNA mutagenic activity at a variety of loci in zebrafish (Run 7)

2017-12-15 | E-MTAB-6355 | biostudies-arrayexpress

Target discrimination in nonsense-mediated mRNA decay requires Upf1 ATPase activity (CLIP-Seq)

2015-07-06 | E-GEOD-69584 | biostudies-arrayexpress