Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

7 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A 3D molecular atlas of the chick embryonic heart

ABSTRACT: We performed a detailed analysis of gene expression in the 2-day (HH12) embryonic chick heart. RNA-seq of 13 microdissected heart regions reveals regionalised expression of about 15,000 genes (Dataset 1). Of these, 131 genes that are differentially expressed (FPKM ≥20, fold change ≥1.1-4.0) within a region compared to the other 12 regions were studied by in situ hybridisation (bold text in Dataset 1) and used to generate a 3D molecular map of the heart at this stage of development.

INSTRUMENT(S): NextSeq 500

ORGANISM(S): Gallus gallus

SUBMITTER: Claudio Stern

PROVIDER: E-MTAB-7663 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Publications

A 3D molecular atlas of the chick embryonic heart.

Anderson Claire C Hill Bill B Lu Hui-Chun HC Moverley Adam A Yang Youwen Y Oliveira Nidia M M NMM Baldock Richard A RA Stern Claudio D CD

Developmental biology 20190705 1

We present a detailed analysis of gene expression in the 2-day (HH12) embryonic chick heart. RNA-seq of 13 micro-dissected regions reveals regionalised expression of 15,570 genes. Of these, 132 were studied by in situ hybridisation and a subset (38 genes) was mapped by Optical Projection Tomography or serial sectioning to build a detailed 3-dimensional atlas of expression. We display this with a novel interactive 3-D viewer and as stacks of sections, revealing the boundaries of expression domain ...[more]

PMID: 31283921

Similar Datasets

Anatomical and molecular dissection of the prestreak chick embryo

Project description:This paper shows detailed information of prestreak stage chick embryos at the morphological level by using scanning electron microscopy, and at the molecular level by RNAseq and expression analysis.

2020-02-12 | E-MTAB-7941 | biostudies-arrayexpress

Transcriptome profiling of hnRNP A2/B1 and A1 depleted cells

Project description:We used NEBNext UltraÂ DirectionalÂ RNA Library Prep Kits to prepare RNA-seq libraries of total RNA from hnRNP A2/B1 and A1 depleted A549 cells. Pro-seq libraries were prepared from A549 cells using Illumina adapters hnRNP A2/B1 and A1 depleted A549 cells were generated by lentiviral infections of shRNA constructs. RNAs were isolated using Trizol.

2016-05-17 | E-GEOD-76151 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

RNA-seq in HAP1 tRNA gene locus deleted clones and control clones

Project description:This dataset contains ploy-A tailed enriched RNA-seq data obtained from single cell-derived control and CRISPR/Cas9 induced tRNA gene deletion clones in the human cancer cell line HAP1. In this study, we found a large genomic deletion of the 10q23 locus in our Cas9 modified clones and further investigate the effect on the transcriptome.

2023-10-24 | E-MTAB-11858 | biostudies-arrayexpress

RNA Seq of the ventricular region from young and aged killifish

Project description:In order to understand molecular basis of cardiac ageing in killifish, we have performed RNA Seq on the ventricular regions of young and aged killifish. Experiment was performed in biological triplicates.

2019-03-22 | E-MTAB-7582 | biostudies-arrayexpress

The genome of the seagrass Zostera marina

Project description:This dataset contains the transcriptome sequence of Zostera marina as produced by Illumina sequencing. Four tissues were sequenced, female flower in late and early stages of development, the male flower, the root and leaf tissue. Full transcriptome sequencing of four tissues, including female flower at two time points in development

2016-01-16 | E-GEOD-67579 | biostudies-arrayexpress

Single-cell RNA-sequencing of cardiac cells isolated from infant mouse at postnatal 3 weeks

Project description:To study the gene profiling of different cardiac adipogenic progenitor populations, we isolated individual cells from postnatal 3-week heart and performed single-cell RNA-sequencing. Single cell suspensions from isolated mouse heart were prepared by retrograde Langendorff perfusion. Briefly, mouse at P3W was administered with 0.2 mL heparin sodium salt solution (1000 IU/mL) via intraperitoneal injection and then euthanized by CO2 asphyxiation. The heart was harvested and hung onto the Langendorff apparatus, followed by perfusing with modified Tyrode’s solution (MTS) for 2 min. The heart was next perfused with MTS containing 0.4 mg/ mL collagenase II and 25 µg/ mL DNase I for 10 min. After removed from cannula, atria and valves were removed and ventricles were minced with fine forceps. Cells were filtered through a 70 µm cell strainer and centrifuged at 30x g for 5 minutes at 4°C to remove most cardiomyocytes. The cell suspension was carefully transferred into a new 15 mL centrifuge tube and centrifuged at 300x g for 5 minutes at 4°C. Cell pellet was washed and suspended in DMEM containing 10% FBS for single-cell sequencing. Single cell library was generated using 10x Genomic Chromium system with the v3 single cell reagent kit. Sequencing of library was performed on Illumina NovoSeq 6000 platform.

2020-07-16 | E-MTAB-9366 | biostudies-arrayexpress

BOLD-100 in Combination With FOLFOX for the Treatment of Advanced Solid Tumours

Project description:BOLD-100 is an intravenously administered sterile solution containing the ruthenium-based small molecule. BOLD-100 has been shown to preferentially decrease the expression of GRP78 in tumour cells and ER stressed cells when compared to normal cells. BOLD-100 will be combined with cytotoxic FOLFOX chemotherapy in this study, with a dose escalation cohort to ensure tolerability and safety, followed by a cohort expansion phase.

| 2341799 | ecrin-mdr-crc

Interaction with ribosomal proteins accompanies ER stress-induction of the anticancer metallodrug BOLD-100/KP1339

Project description:The ruthenium-based anticancer agent BOLD-100/KP1339 has shown promising results in several in vitro and in vivo tumour models, as well as in early clinical trials. However, its mode of action remains to be fully elucidated. Recent evidence identified ER stress-induction and concomitant down-modulation of HSPA5 (GRP78) as key drug effects. By exploiting the naturally formed adduct between BOLD-100 and human serum albumin as an immobilization strategy, we were able to perform target profiling experiments that revealed the ribosomal proteins RPL10, RPL24 and the transcription factor GTF2I as potential interactors of this ruthenium(III) anticancer agent. Integrating these findings with proteomic profiling and transcriptomic experiments supported ribosomal disturbance and concomitant induction of endoplasmic reticulum (ER) stress. The formation of poly-ribosomes and ER swelling of treated cancer cells by electron microscopy validated this finding. Thus, the direct interaction of BOLD-100 with ribosomal proteins seems to accompany ER stress-induction and modulation of GRP78 in cancer cells.

2021-06-01 | PXD022449 | Pride

Bioinformatic analysis of membrane and associated proteins in murine cardiomyocytes and human myocardium

Project description:In the current study we examined several proteomic- and RNA-Seq-based datasets of cardiac-enriched, cell-surface and membrane-associated proteins in human fetal and mouse neonatal ventricular cardiomyocytes. By integrating available microarray and tissue expression profiles along with MGI phenotypic analysis, we identified 173 membrane-associated proteins that are cardiac-enriched, conserved amongst eukaryotic species, and have not yet been linked to a ‘cardiac’ Phenotype-Ontology. To highlight the utility of this dataset, we selected several proteins to investigate more carefully, including FAM162A, MCT1, and COX20, to show cardiac enrichment, subcellular distribution and expression patterns in disease. Three-dimensional imaging was used to validate subcellular localization and expression in adult mouse ventricular cardiomyocytes. FAM162A, MCT1, and COX20 were differentially expressed at the transcriptomic and proteomic levels in multiple models of mouse and human heart diseases and may represent potential diagnostic and therapeutic targets for human dilated and ischemic cardiomyopathies. Altogether, we believe this comprehensive cardiomyocyte membrane proteome dataset will prove instrumental to future investigations aimed at characterizing heart disease markers and/or therapeutic targets for heart failure.

2020-11-17 | PXD017732 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data