Browse
Submit Data
Databases
API
Help

Metabolomics,Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide analysis of gene expression in NMC cell line HCC2429 incubated with A-485 and JQ1 alone or combined

ABSTRACT: P300/CBP and BET inhibition have synergistic effects in NMC. To explore the molecular mechanisms of this synergistic effect, transcriptomic profiling was performed in HCC2429 cells incubated with 250 nM A-485 and 50 nM JQ1 alone or combined.

ORGANISM(S): Homo sapiens

SUBMITTER: Xin Zhang

PROVIDER: E-MTAB-8955 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Combined targeting of the BRD4-NUT-p300 axis in NUT midline carcinoma by dual selective bromodomain inhibitor, NEO2734

Project description:NUT midline carcinoma (NMC) is a rare, aggressive subtype of squamous carcinoma that is driven by the BRD4-NUT fusion oncoprotein. BRD4, a BET protein, binds to chromatin through its two bromodomains, and NUT recruits the p300 histone acetyltransferse (HAT) to activate transcription of oncogenic target genes. BET selective bromodomain inhibitors have demonstrated on-target activity in NMC patients, but with limited efficacy. P300, like BRD4, contains a bromodomain. We show that combining selective p300/CBP and BET bromodomain inhibitors, GNE-781 and OTX015, respectively, induces synergistic inhibition of NMC growth. Treatment of NMC cells with the novel dual p300/CBP and BET bromodomain selective inhibitor, NEO2734, potently inhibits growth and induces differentiation of NMC cells in vitro; findings that correspond with potentiated transcriptional effects from combined BET and p300 bromodomain inhibition. In three disseminated NMC xenograft models, NEO2734 provided greater growth inhibition, with tumor regression and significant survival benefit seen in two of three models, compared with a lead clinical BET inhibitor or 'standard' chemotherapy.

2020-06-19 | GSE142481 | GEO

p53-ko rescues gene expression changes mediated by p300 acetyltransferase inhibition

Project description:RNA-seq samples in BIN-67 and BIN-67p53-ko cells with or without A-485 treatment (1μM, 24h). The goal of the experiment is to assess the genes that are regulated by p300 acetyltransferase inhibition using A-485 treatment and weather p53-ko can rescue this phenotype.

2026-05-05 | E-MTAB-15706 | biostudies-arrayexpress

Differential gene expression in neuroblastoma cells after treatment with vehicle control, JQ1, panobinostat, or combination of JQ1 and panobinostat

Project description:The bromodomain inhibitor JQ1 and the histone deacetylase inhibitor panobinostat induce synergistic anticancer effects We analyzed whether JQ1 and panobinostat synergistically modulate gene expression Neuroblastoma SK-N-BE(2) cells were treated with vehicle control, 1 microM JQ1, 10 nM panobinostat, or combination of JQ1 and panobinostat for 6 hours, and subjected to differential gene expression studies with Affymetrix microarrays.

2015-12-31 | E-GEOD-68690 | biostudies-arrayexpress

EP300 acetyltransferase inhibition in SCCOHT cell lines

Project description:RNA-seq samples in BIN-67, COV434, SCCOHT-1 cells including Control (Ctrl.) and A-485 treatment (24h, 1μM)

2026-05-05 | E-MTAB-15705 | biostudies-arrayexpress

RNA-seq of matched breast cancer and brain metastasis cell lines

Project description:In-depth RNA expression analysis of four human derived breast cancer cell lines and their brain metastatic counterpart.

2025-08-22 | E-MTAB-15278 | biostudies-arrayexpress

Functional metabolic phenotyping of human pancreatic ductal adenocarcinoma (Xenografts)

Project description:Gene expression analysis was performed on tumor-derived RNA from human PDAC xenograft to study the metabolic differences in the different PDAC subtypes

2021-12-31 | E-MTAB-10784 | biostudies-arrayexpress

Targeted sequencing of reporter transcripts with variable GA-multivalency and intron content

Project description:These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. The reporter pool was expressed either via plasmid transfection or from a dox-incudible promoter. Cells were then fractionated to obtain nuclear and cytoplasmic RNA, and the barcode sequences were amplified to determine the abundance of each different reporter transcript in each fraction. Experiments were performed in triplicate and the nuclear and cytoplasmic fractions for all replicates were multiplexed into one file, which is provided here. Different expression times were sampled to determine how nuclear/cytoplasmic localisation changed in response to changes in PPIG-LCD protein accumulation. In one instance, the effect of the CLK inhibitor CLK-IN-T3 was tested. Multiple experimental conditions are provided: Experiment 1: transfection for 16 hours. Experiment 2: transfection for either 8 or 24 hours. Experiment 3: dox-induction for either 4, 8, or 12 hours. Note: expression kinetics are faster with dox induction than transfection. Experiment 4: dox-induction for 6 hours, either with 1 uM CLK-IN-T3 treatment, or with equivalent volume DMSO. Treatment began 2 hours before dox-induction. Each correct read in each sample should contain the following sequences in the following order: UMIs (N) and experimental barcodes (B): NNNNNBBBBNNNNN A fixed sequence: GGCCTGCGGATCC A unique plasmid barcode, which identifies the reporter transcript: NNNNNNNNNNNNNNNNNNNN A fixed sequence: GTTGTCGATCGAGACGTAAT Illumina adapter sequences. The experimental barcode arrangement for each sample is provided as a supplement to this accession.

2025-07-29 | E-MTAB-13329 | biostudies-arrayexpress

Long read sequencing of reporter plasmids and RNA

Project description:These experiments use a barcoded pool of reporter transcripts, each of which encode the same mScarlet-PPIG_LCD fusion protein, but using different degrees of GA-multivalency via codon bias, and containing a different number of constitutive introns. In order to be able to perform experiments using this pool, it was necessary to perform long-read sequencing of the plasmid pool to relate the barcodes in the 3' ends of the reporter to their gene structure. Therefore, we performed long-read sequencing of the plasmid pool (both the original pool used for transfection and the ePB plasmid used for PiggyBac integration). Furthermore, to determine the splicing patterns of the reporter genes, we transfected the plasmid pool into HeLa cells for 16 hours, then performed targeted long-read sequencing of the reporter plasmids via RT-PCR. Note: the Nanopore adapter ligation strategy means that reads can come in either orientation. To determine the gene architectures and barcodes, we used fuzzy string matching. First we matched to various fixed sequences throughout the reporter transcripts to determine the orientation of the read and that the read spanned the full length of the transcript. Then we used the same string matching strategy to detect the presence of the different intronic or exonic sequences - the gene architecture. Then we extracted the associated unique plasmid barcode associated with that gene architecture. Example reporter sequences can be found here: https://benchling.com/faraway/f_/kXCfddtQ-public-reporter-plasmid-maps/ or alternatively, in Supplemental Table 2 of the bioRxiv submission here: https://www.biorxiv.org/content/10.1101/2023.08.21.554177v1.supplementary-material

2025-07-29 | E-MTAB-13330 | biostudies-arrayexpress

RNA-seq of anaplastic thyroid carcinoma cell line (8505c) after overexpression of OVOL2

Project description:Identification of OVOL2-related transcriptional program in anaplastic thyroid carcinoma-derived cell line, 8505c. Doxycycline-inducible system was obtained by infecting 8505c cells with lentiviral vector containing OVOL2 coding sequence fused with HA tag. Control cells were infected with empty vector (EV). Cells were collected 24 hours upon doxycycline treatment.

2023-10-05 | E-MTAB-11055 | biostudies-arrayexpress

3' sequencing of nuclear and cytoplasmic fractions following treatment with a CLK inhibitor

Project description:CLK kinases phosphorylate the SR domains of SR proteins. The phosphorylation state controls the localisation of SR proteins, with hypo-phosphorylated SR proteins being more enriched in nuclear speckles. We identified a set of mRNAs that are bound by SR proteins in the nucleus, and we wondered whether the activity of CLK kinases would alter the nuclear export of those mRNAs. We therefore treated HeLa cells with the CLK inhibitor CLK-IN-T3 or with DMSO for 8 hours and then collected nuclear and cytoplasmic fractions. We sequenced the 3' ends of poly-adenylated mRNAs in these fractions. The samples in this accession have been trimmed to remove Illumina adapters, 3' poly-A stretches, 5' G stretches from the TSO oligo and the UMIs have been moved to the header. The data was then processed using the following nf-core/rnaseq call: nextflow run nf-core/rnaseq \\ --input 'samplesheet.csv' \\ --fasta '/camp/lab/ulej/home/users/farawar/genomes/hs/fasta/GRCh38.primary_assembly.genome.fa' \\ --gtf '/camp/lab/ulej/home/users/farawar/genomes/hs/annotation/gencode.v29.annotation.gtf' \\ --salmon_index '/camp/lab/ulej/home/users/farawar/genomes/hs/salmon_index/salmon_index' \\ --gencode \\ --pseudo_aligner salmon \\ -resume \\ -profile crick \\ --outdir nf-core \\ -c extraconfig.config With the extra config file containing the following: withName: '.*:QUANTIFY_STAR_SALMON:SALMON_QUANT' { ext.args = '--noLengthCorrection' }

2025-07-29 | E-MTAB-13328 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data