RNA-seq of human neuroblastoma cell lines treated with ALKAL2 and/or lorlatinib
Ontology highlight
ABSTRACT:
INSTRUMENT(S): Illumina NovaSeq 6000
ORGANISM(S): Homo sapiens
SUBMITTER: Jimmy Van den Eynden
PROVIDER: E-MTAB-9598 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:ALK is a tyrosine kinase receptor and oncogene in neuroblastoma (NB). The receptor is activated by the ALKAL2 ligand, but it is unknown whether missregulation of this ligand may play a role in NB carcinogenesis. Here, a TH-MYCN driven neuroblastoma mice was created +/- ALK F1178S mutation and +/- ALKAL2 overexpression
2020-11-24 | E-MTAB-9600 | biostudies-arrayexpress
Project description:High-risk neuroblastoma (NB) is notoriously difficult to treat and is responsible for a disproportionate number of childhood deaths due to cancer. One long accepted indicator of high-risk NB and poor prognosis is amplification of the neural MYC (MYCN) oncogene, which is currently therapeutically intractable in this patient population. The identification of Anaplastic Lymphoma Kinase (ALK) as an oncogene in NB raised the possibility of using ALK tyrosine kinase inhibitors (TKIs) in the treatment of NB patients who harbor activating ALK mutations. The number of ALK-positive NB patients on primary diagnosis is in the range of 8-10%, a figure that increases substantially in the relapsed patient population. ALK signaling is activated by the ALKAL2 ligand located on the distal portion of chromosome 2, along with the ALK receptor and MYCN loci, in the ‘2p gain’ region that has been associated with NB. The question of whether dysregulation of ALK ligand may also play a role in NB has not been addressed, although notably, one of the first oncogenes described was the v-sis oncogene that shares more than 90% homology with the PDGF ligand. Therefore, we tested whether ALKAL ligand was able to potentiate NB progression in the absence of ALK mutation. We show here that overexpression of ALKAL2 is sufficient to drive rapid onset and penetrant Th-MYCN driven NB in the absence of ALK mutation, and that these tumours are sensitive to ALK TKI therapy. These results suggest that additional NB patients, such as those exhibiting 2p gain, may also benefit from ALK TKI based therapeutic intervention.
2020-11-25 | PXD021792 | Pride
Project description:Aberrant activation of Anaplastic Lymphoma Kinase (ALK) drives neuroblastoma (NB). Previous work has identified the RET receptor tyrosine kinase (RTK) as a downstream target of ALK activity in NB models. We show here that ALK activation in response to ALKAL2 ligand results in the rapid phosphorylation of RET in NB cells, providing additional insight into the contribution of RET to the ALK driven gene signature in NB. To further address the role of RET in NB, RET knock-out (KO) SK-N-AS cells were generated by CRISPR/Cas9 genome engineering. Gene expression analysis of RET KO NB cells identified a reprogramming of NB cells to a mesenchymal (MES) phenotype that was characterized by increased migration and upregulation of the AXL and MET RTKs as well as integrins and extracellular matrix components. Strikingly, the upregulation of AXL in the absence of RET reflects the development timeline observed in the neural crest as progenitor cells undergo differentiation during embryonic development. Together, these findings suggest that a MES phenotype is promoted in mesenchymal NB cells in the absence of RET, reflective of a less differentiated developmental status.
2021-09-10 | PXD024551 | Pride
Project description:The discovery of either missense mutations or amplification of ALK (Anaplastic Lymphoma Kinase) gene identified this receptor tyrosine kinase as a therapeutic target in neuroblastoma (NB). Moreover, a high ALK expression has been associated with cases of metastatic NB and with a worse prognosis. In order to identify miRNAs involved in the regulation of ALK expression in NB we therefore analyzed their expression profile in 16 NB cell lines and in 22 patients by qPCR. We then identified miRNAs which were differentially expressed between two groups of samples showing high (ALK+) or low (ALK-) expression levels of ALK by using microarrays containing 866 human miRNA probes (Agilent). Next, the differential expression analysis between the two groups (ALK+ and ALK-) was performed using R. Our analysis showed a higher expression of 30 and 23 miRNAs (p-value <0.05) in NB lines and samples, respectively, both belonging to the ALK- group. Validation analysis and filtering according to in silico suggested miR-424-5p as a potential ALK regulator candidate. Dual luciferase assay indicated a direct binding of this miRNA to ALK-3’UTR. Moreover, we observed a down-regulation of ALK protein expression following transfection of miR-424-5p mimic as well as inhibition of cell viability in ALK+ NB cell lines. In conclusion, our data suggest miR-424-5p as involved in the regulation of ALK expression in NB.
2017-04-30 | GSE86652 | GEO
Project description:The discovery of either missense mutations or amplification of ALK (Anaplastic Lymphoma Kinase) gene identified this receptor tyrosine kinase as a therapeutic target in neuroblastoma (NB). Moreover, a high ALK expression has been associated with cases of metastatic NB and with a worse prognosis. In order to identify miRNAs involved in the regulation of ALK expression in NB we therefore analyzed their expression profile in 16 NB cell lines and in 22 patients by qPCR. We then identified miRNAs which were differentially expressed between two groups of samples showing high (ALK+) or low (ALK-) expression levels of ALK by using microarrays containing 866 human miRNA probes (Agilent). Next, the differential expression analysis between the two groups (ALK+ and ALK-) was performed using R. Our analysis showed a higher expression of 30 and 23 miRNAs (p-value <0.05) in NB lines and samples, respectively, both belonging to the ALK- group. Validation analysis and filtering according to in silico suggested miR-424-5p as a potential ALK regulator candidate. Dual luciferase assay indicated a direct binding of this miRNA to ALK-3’UTR. Moreover, we observed a down-regulation of ALK protein expression following transfection of miR-424-5p mimic as well as inhibition of cell viability in ALK+ NB cell lines. In conclusion, our data suggest miR-424-5p as involved in the regulation of ALK expression in NB.
2017-04-30 | GSE84841 | GEO
Project description:ALK is driving neuroblastoma (NB) and RET has been shown to be a downstream target of ALK signaling in NB. To get a better understanding of the role of RET in NB, the gene was knocked out in SKNAS cell lines.
2021-04-14 | E-MTAB-10032 | biostudies-arrayexpress
Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.
2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress
Project description:Anaplastic Lymphoma Kinase (ALK) is a tyrosine kinase receptor which is a clinical target of major interest in cancer, including neuroblastoma. To better understand ALK signaling, three different neuroblastoma cell lines (CLB-BAR, CLB-GE and SK-N-AS) were cultured for 1hr and 24hrs in control conditions or after treatment with the ALK inhibitors crizotinib or lorlatinib. RNA-Seq experiments were performed to determine the expression changes resulting from ALK inhibition. Together with parallel phosphoproteomic experiments, these data unveil several important conserved oncogenic pathways in neuroblastoma.
2018-09-01 | E-MTAB-6654 | biostudies-arrayexpress
Project description:The prognosis of advanced stage neuroblastoma patients remains poor and, despite intensive therapy, the 5-year survival rate remains less than 50%. We previously identified histone deacetylase (HDAC) 8 as an indicator of poor clinical outcome and a selective drug target for differentiation therapy in vitro and in vivo. Here we performed kinome-wide RNAi screening to identify genes that are synthetically lethal with HDAC8 inhibitors. These experiments identified the neuroblastoma predisposition gene ALK as a candidate gene. Accordingly, the combination of the ALK/MET inhibitor crizotinib and selective HDAC8 inhibitors (3-6μM PCI-34051 or 10μM 20a) efficiently killed neuroblastoma cell lines carrying wildtype ALK (SK-N-BE(2)-C, IMR5/75), amplified ALK (NB-1), and those carrying the activating ALK F1174L mutation (Kelly), and, in cells carrying the activating R1275Q mutation (LAN-5), combination treatment decreased viable cell count. The effective dose of crizotinib in neuroblastoma cell lines ranged from 0.05μM (ALK-amplified) to 0.8μM (wildtype ALK). The combinatorial inhibition of ALK and HDAC8 also decreased tumor growth in an in vivo zebrafish xenograft model. Bioinformatic analyses revealed that the mRNA expression level of HDAC8 was significantly correlated with that of ALK in two independent patient cohorts, the Academic Medical Center cohort (n=88) and the German Neuroblastoma Trial cohort (n=649), and co-expression of both target genes identified patients with very poor outcome. Mechanistically, HDAC8 and ALK converge at the level of receptor tyrosine kinase (RTK) signaling and their downstream survival pathways, such as ERK signaling. Combination treatment of HDAC8 inhibitor with crizotinib efficiently blocked the activation of growth receptor survival signaling and shifted the cell cycle arrest and differentiation phenotype toward effective cell death of neuroblastoma cell lines, including sensitization of resistant models, but not of normal cells. These findings reveal combined targeting of ALK and HDAC8 as a novel strategy for the treatment of neuroblastoma.
2018-02-21 | GSE110817 | GEO
Project description:Neuroblastoma is an embryonal neoplasm that remains of dramatic prognosis in its aggressive forms. Activating mutations of the ALK tyrosine kinase receptor have been identified in sporadic and familial cases of this cancer. We generated knock-in mice carrying the two most frequent Alk mutations observed in neuroblastoma patients. We used microarrays to detail the global programme of gene expression underlying the impact of ALK mutations on neuroblastoma formation in a MYCN amplified background. We selected several murine neuroblastoma tumors for RNA extraction and hybridization on Affymetrix microarrays. We generated three groups of tumors: 10 MYCN amplified tumors, 11 MYCN amplified/ALK F1174L tumors and 10 MYCN amplified/ALK R1275Q tumors.
2014-06-24 | E-GEOD-46583 | biostudies-arrayexpress