Chromatin immunoprecipitation to identify histone modification profiles in wild type and Kcnq1ot1 promoter deletion mouse liver and placenta
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
SUBMITTER: Chandrasekhar Kanduri
PROVIDER: E-TABM-529 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:This SuperSeries is composed of the SubSeries listed below. Refer to individual Series
2013-11-22 | E-GEOD-45616 | biostudies-arrayexpress
Project description:Define and compare H3K4me2 enrichment in OCI-Ly1 and OCI-Ly7 cell lines. Using ChIP-seq, we examined the H3K4me2 genomic enrichment locations in two biological replicates in each cell line
2015-08-28 | E-GEOD-67381 | biostudies-arrayexpress
Project description:Proper regulation of chromatin structure is necessary for the maintenance of cell type-specific gene expression patterns. The embryonic stem cell (ESC) expression pattern governs self-renewal and pluripotency. Here, we present an RNAi screen in mouse ESCs of 1008 loci encoding chromatin proteins. We identified 68 proteins that exhibit diverse phenotypes upon knockdown (KD), including seven subunits of the Tip60-p400 complex. Phenotypic analyses revealed that Tip60-p400 is necessary to maintain characteristic features of ESCs. We show that p400 localization to the promoters of both silent and active genes is dependent upon histone H3 lysine 4 trimethylation (H3K4me3). Furthermore, the Tip60-p400 KD gene expression profile is enriched for developmental regulators and significantly overlaps with that of the transcription factor Nanog. Depletion of Nanog reduces p400 binding to target promoters without affecting H3K4me3 levels. Together, these data indicate that Tip60-p400 integrates signals from Nanog and H3K4me3 to regulate gene expression in ESCs. Keywords: ChIP-chip We identified genes encoding subunits of the Tip60-p400 complex in an RNAi screen of chromatin proteins in mouse embryonic stem cells (ESCs), which upon depletion resulted in a dramatic phenotype. To investigate the role of this complex in gene expression in ESCs, we performed ChIP-chip location analysis using genome-wide promoter tiling arrays. We immunoprecipitated chromatin with an antibody to p400 and competitively hybridized it to input material on two arrays with probes interrogating essentially all mouse promoters with 100 bp tiling of -3250 bp to +750 bp around the transcription start sites.
2008-07-11 | E-GEOD-11241 | biostudies-arrayexpress
Project description:We identified KMT2D target loci in OCI-LY7 by ChIPseq. KMT2D ChIPseq was carried out in the LY7 cell line (n=1).
2015-08-28 | E-GEOD-67314 | biostudies-arrayexpress
Project description:CRZ1 (Calcineurin Responsive Zinc finger 1) is a conserved transcription factor that relays Ca2+/calcineurin signals within the cell. To catalog genome wide locations that MoCRZ1 binds to, we have conducted chromatin immunoprecipitation coupled with microarray (ChIP-chip) in the rice blast fungus, Magnaporthe oryzae. Fungal mycelia were treated with 200mM CaCl2 to activate translocation of MoCRZ1 to the nucleus, thereby binding to the promoter regions of downstream genes, and CaCl2 together with 10ug/ml FK506 to block these phenomena. Using ChIP-chip, we were able to identify over 100 direct targets of MoCRZ1 which include well known downstream genes as well as previously unknown genes. Fungal mycelia expressing MoCRZ1::GFP under its native promoter were treated with 200mM CaCl2. MoCRZ1 bound DNA fragments which were immunoprecipitated with antiGFP-antibody were compared with 30% input DNA. Mycelia treated with 200mM CaCl2 and 10ug/ml FK506 were processed as the same way and used as negative control treatment.
2010-09-17 | E-GEOD-18080 | biostudies-arrayexpress
Project description:Direct gene targets of HepG2 cells transduced with Adenoviral vector carrying HBx vs Adenoviral vector under UV treatment Keywords: ChIP-chip profiling One-condition experiment, AdHBx (experimental) UV vs AdEasy (vector control) UV. HepG2 cells were infected with either recombinant HBx adenoviruses (AdHBx) or control adenoviruses (AdEasy). Seventy-two hours later, infected cells were exposed for 30 seconds to UVC (254 nm) irradiation with a germicidal lamp calibrated to deliver 8 or 16 J/m2. Cells were then harvested for either ChIP-chip profiling or expression microarray profiling.
2008-07-01 | E-GEOD-11106 | biostudies-arrayexpress
Project description:Epstein-Barr virus (EBV) is a ubiquitous gammaherpes virus that establishes a life-long latency in over 90% of the world's population. Epstein Barr Nuclear Antigen 1, EBNA1, is the only viral protein consistently detected in all viral latency programs, as well as in all forms of EBV-associated malignancies. EBNA1 plays critical roles in the viral life cycle by fostering the replication and maintenance of the extrachromosomal viral genome as well as enhancing transcription from multiple viral promoters. Using chromatin immunoprecipitation and human promoter microarrays (an analysis termed ChIP-chip) we found that EBNA1 binds site specifically within multiple human promoters. To determine whether EBNA1â??s binding to these promoters perturbed gene expression, we measured the levels of cellular mRNAs by microarrays when EBNA1 was inhibited by a dominant negative derivative of EBNA1 (DomNeg1). Keywords: viral regulation of cellular genes We analysed mRNA expression from the EBV-positive lymphoblastoid cell line 721 transduced with either a control (empty) retroviral vector or a DomNeg1-encoding retroviral vector. For ChIP-chip, DNA from immunoprecipitated chromatin using a anti-EBNA1 antibody (IH4) along with total chromatin was hybridized to a Nimblegen human promoter arrays (CHAR0150-HP2). A single ChIP-chip experiment was performed with DNAs pooled equally from three independent ChIP experiments.
2010-05-14 | E-GEOD-13315 | biostudies-arrayexpress
Project description:Define and compare H3K4me2 enrichment in murine B220 cells transduced with empty vector (ct) or KMT2D-shRNA. Compare gene expression by RNAseq in murine B220 cells transduced with empty vector (ct) or KMT2D-shRNA. Using H3K4me1/2 ChIPseq and RNAseq we profiled murine B220 purified cells from tumors transduced with EV (n=3) or KMT2D-shRNA (n=3).
2015-08-28 | E-GEOD-67291 | biostudies-arrayexpress
Project description:Interferon regulatory factor 4 (IRF4) is a master transcription factor required for the maturation of germinal center B cells that eventually develop into antibody secreting plasma cells and memory B cells. IRF4-deficient mice exhibit a profound reduction in serum immunoglobulin levels. In spite of wealth of the information relating to IRF4 and B cell biology, little is known about the intricate molecular details of the role of this transcription factor during B cell development. We therefore examined the genome-wide targets of IRF4 by ChIP-chip analysis in GC derived BL2 Burkittâ??s lymphoma cells. ChIP studies were further supplemented by whole genome expression analysis after shRNA-mediated knockdown of IRF4. Our study revealed that IRF4 regulates expression of genes important for a) BCR signaling b) antigen processing and presentation by MHC. In addition we found that IRF4 possibly in some way involved to regulate LTA, LTB and CXCR5 those involved in immune system development, particularly light zone development related genes such as FDC clustering regulating and IL21R and IL10 who are involved in B cell development.. On the other hand, IRF4 suppressesd genes in the oxidative phosphorylation pathway. Our findings illuminate hitherto unexplored roles of IRF4 in GC B cell development. ChIP-chip was performed following the protocols described before [Lian Z, et al.,Genome Res. 18: 1224, 2008] with slight modifications. Briefly, 3X10^8 BL2 cells were cross-linked in 1% formaldehyde for 10 mins at room temperature and then the cells were lysed in RIPA buffer(0.1% SDS) containing protease inhibitors(Roche Inc) . Cell suspensions were sonicated under ice-cold conditions using a Branson 250 Sonifier (Branson, Danbury, CT) with a power setting 60%, fifteen 30-sec pulses on ice to shear the chromatin to a size of approximately 300-500b. Anti-IRF4 antibody (sc6059 Santa Cruz Biotechnology, Santa Cruz, CA) or normal pre-immune mouse serum IgG as a control were added to the suspensions. The suspension was incubated at 4C rotating overnight to allow the antibodies to bind to DNA fragments. Protein G beads were added next day and incubated at 4C with gentle agitation for 1 hr. The antibodyâ??DNA complexes were eluted from the beads by 1% SDS in TE incubated at 65°C. The beads were sedemented by centrifugation, and the supernatants were incubated overnight at 65°C to reverse the cross-linking in the chromatin-protein complex. RNA contamination was eliminated by incubating the samples with 200 mg of Rnase for 1 hour at 37°C. Finally, proteinase K (400 μg of proteinase K/mL, 1X TE) was added, and the samples were incubated for 2 h at 45°C, followed by a phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation to recover the DNA. Immunoprecipitated DNA was analyzed by PCR for the enriched factor binding at target sequences. In some cases we did LM-PCR, about 20-100ng of the ChIP-DNA was blunt-ended by T4 DNA polymerase (New England Biolabs, Boston MA), then ligated with pre-annealed oligonucleotide linkers (oligo-1: GCGGTGACCCGGGAGATCTGAATTC, oligo-2: GAATTCAGATC) using T4 DNA ligase (New England Biolabs) at 16°C overnight. The ligated DNA was further amplified by PCR with oligo-1 as a PCR primer, followed by purification using the Qiaquick PCR purification kit (Qiagen). We used Nimblegen high density promoter arrays based on human genome HG17 (Nimblegen System INC. Reykjavik Iceland).Taq Mastermix (QIAGEN) was used for PCR amplification under the following reaction conditions: 5 min at 94°C, 30 cycles of 30 sec at 94°C, 30 sec at 53°C, 30 sec at 72°C, and 10 min at 72°C. PCR products were analyzed by gel electrophoresis. DNA samples to be hybridized to microarrays were labeled by random priming with nonamer oligonucleotides attached to Cy3 or Cy5 dyes. Control samples for the chromatin immunoprecipitation experiments were total genomic DNA prepared from chromatin cross-linked and precipitated by the same procedure as the test sample but with non-specific IgG.. Test samples were labeled with Cy5 and applied to the same chip as the Cy3-labeled control sample. ChIP DNA samples were randomly primed with Cy3 and Cy5 random nonomers or septamers and the labeled fragments were hybridized to the promoter arrays. Data analysis was carried out by Tilescope [Lian Z, et al.,Genome Res. 18: 1224, 2008] and Integrated Genome Browser (IGB). Nimblegen ChIP-chip data were processed by automated Tilescope analysis [Zhang ZD, et al., Genome Biol. 8: R81, 2007]. The program normalizes Cy3 and Cy5 files of the tiling array results and identifies regions with statistically significant binding enrichment. Visualization and further analysis of the data were carried out using the IGB program (http://www.affymetrix.com/partners_programs/programs/developer/tools/download_igb.affx) and Database for Annotation, Visualization and Integrated Discovery (http://david.abcc.ncifcrf.gov/summary.jsp).
2015-12-15 | E-GEOD-64268 | biostudies-arrayexpress
Project description:ChIP-on-Chip experiment using chromatin from the human adult ovarian granulosa cell tumor derived cell line KGN (Nishi et al, 2001), or from a KGN subclone overexpressing WT FOXL2 (KF3 subclone), and an isovolumic blend of our custom anti-FOXL2 polyclonal antibodies (Cocquet J et al, 2002). Non precipitated sheared matched deproteinized chromatin (Input) was used a control to estimate enrichment peaks (and thus FOXL2 binding sites) from IPed DNA. DNA from three independent ChIP assays (Input extractions) was pooled, and 100ng of DNA was linearly amplified using the Whole Genome Amplification kit (Sigma). The two ChIP-chip experiments serve as biological replicates. Moreover, 42 out of 48 targets promoters chosen from the âenrichment peakâ list were subsequently confirmed as enrichment sites in anti-FOXL2 ChIPed DNA for subsequent experiments.
2011-02-22 | E-MTAB-399 | biostudies-arrayexpress