Dataset Information

[Genotype and phenotype analysis of a family with Waardenburg syndrome type Ⅰcaused by a novel mutation in PAX3 gene].

ABSTRACT: Objective:To identify gene mutation and analysis the association between clinical characterizes and the mutations in a family of Waardenburg syndrome （WS） type I in Yunnan, China. Methods:With informed consent, the proband with WS phenotype and his family members were given medical history collection, physical examination and audiological evaluation. Peripheral blood was obtained, genomic DNA was extracted, and deafness related genes were detected by high-throughput sequencing. Sanger sequencing was used to verify the mutation sites of proband and his family members. Results:C. 602C>G mutation in exon 5 of PAX3 gene was identified, which is nonsense mutation and may cause a truncated protein. The mutation cause 201 amino acid of the protein changed from serine to stop codon. According to the American College of Medical Genetics and Genomics （ACMG）, it is considered as Pathogenicity（PVS1+PM2+PP3）. This mutation has not been included in the database also not been reported in the literature. Conclusion:Combined with the results of clinical diagnosis and gene diagnosis, this mutation was considered as the cause of the disease. This study enriched mutation spectrum of PAX3 gene.

SUBMITTER: Li X

PROVIDER: S-EPMC10127909 | biostudies-literature | 2021 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

[Genotype and phenotype analysis of a family with Waardenburg syndrome type Ⅰcaused by a novel mutation in PAX3 gene].

Li Xia X Zhao Shengbo S Bi Xianyun X Lou Fan F Zeng Wenjuan W Gao Yan Y Mao Zhiyong Z Ma Jing J

Lin chuang er bi yan hou tou jing wai ke za zhi = Journal of clinical otorhinolaryngology head and neck surgery 20210701 7

Objective:To identify gene mutation and analysis the association between clinical characterizes and the mutations in a family of Waardenburg syndrome （WS） type I in Yunnan, China. Methods:With informed consent, the proband with WS phenotype and his family members were given medical history collection, physical examination and audiological evaluation. Peripheral blood was obtained, genomic DNA was extracted, and deafness related genes were detected by high-throughput sequencing. San ...[more]

PMID: 34304492

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Dataset Information

[Genotype and phenotype analysis of a family with Waardenburg syndrome type Ⅰcaused by a novel mutation in PAX3 gene].

Publications

[Genotype and phenotype analysis of a family with Waardenburg syndrome type Ⅰcaused by a novel mutation in <i>PAX3</i> gene].

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets