Ontology highlight
ABSTRACT:
SUBMITTER: Bao X
PROVIDER: S-EPMC10704694 | biostudies-literature | 2023 Dec
REPOSITORIES: biostudies-literature

Bao Xiuqin X Qin Danqing D Wang Jicheng J Chen Jing J Yao Cuize C Liang Jie J Liang Kailing K Wang Yixia Y Wang Yousheng Y Du Li L Yin Aihua A
Human genomics 20231208 1
<h4>Background</h4>β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.<h4>Results</h4>In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β<sup>CD59</sup>) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β<sup>CD128-134</sup>) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. Howev ...[more]