Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

A Ruthenium(II) Polypyridyl Complex Disrupts Actin Cytoskeleton Assembly and Blocks Cytokinesis.

ABSTRACT: The dinuclear Ru^II complex [(Ru(phen)₂)₂(tpphz)]⁴⁺ (phen=1,10-phenanthroline, tpphz=tetrapyridophenazine) "RuRuPhen" blocks the transformation of G-actin monomers to F-actin filaments with no disassembly of pre-formed F-actin. Molecular docking studies indicate multiple RuRuPhen molecules bind to the surface of G-actin but not the binding pockets of established actin polymerisation inhibitors. In cells, addition of RuRuPhen causes rapid disruption to actin stress fibre organisation, compromising actomyosin contractility and cell motility; due to this effect RuRuPhen interferes with late-stage cytokinesis. Immunofluorescent microscopy reveals that RuRuPhen causes cytokinetic abscission failure by interfering with endosomal sorting complexes required for transport (ESCRT) complex recruitment.

SUBMITTER: Gill MR

PROVIDER: S-EPMC10947085 | biostudies-literature | 2022 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

A Ruthenium(II) Polypyridyl Complex Disrupts Actin Cytoskeleton Assembly and Blocks Cytokinesis.

Gill Martin R MR Jarman Paul J PJ Hearnden Vanessa V Fairbanks Simon D SD Bassetto Marcella M Maib Hannes H Palmer John J Ayscough Kathryn R KR Thomas Jim A JA Smythe Carl C

Angewandte Chemie (Weinheim an der Bergstrasse, Germany) 20220509 27

The dinuclear RuII complex [(Ru(phen)2)2(tpphz)]4+ (phen=1,10-phenanthroline, tpphz=tetrapyridophenazine) "RuRuPhen" blocks the transformation of G-actin monomers to F-actin filaments with no disassembly of pre-formed F-actin. Molecular docking studies indicate multiple RuRuPhen molecules bind to the surface of G-actin but not the binding pockets of established actin polymerisation inhibitors. In cells, addition of RuRuPhen causes rapid disruption to a ...[more]

PMID: 38505667

Similar Datasets

A Ruthenium(II) Polypyridyl Complex Disrupts Actin Cytoskeleton Assembly and Blocks Cytokinesis.

Project description:The dinuclear RuII complex [(Ru(phen)2 )2 (tpphz)]4+ (phen=1,10-phenanthroline, tpphz=tetrapyridophenazine) "RuRuPhen" blocks the transformation of G-actin monomers to F-actin filaments with no disassembly of pre-formed F-actin. Molecular docking studies indicate multiple RuRuPhen molecules bind to the surface of G-actin but not the binding pockets of established actin polymerisation inhibitors. In cells, addition of RuRuPhen causes rapid disruption to actin stress fibre organisation, compromising actomyosin contractility and cell motility; due to this effect RuRuPhen interferes with late-stage cytokinesis. Immunofluorescent microscopy reveals that RuRuPhen causes cytokinetic abscission failure by interfering with endosomal sorting complexes required for transport (ESCRT) complex recruitment.

| S-EPMC9323417 | biostudies-literature

Disruption of microtubule function in cultured human cells by a cytotoxic ruthenium(ii) polypyridyl complex.

Project description:Treatment of malignant and non-malignant cultured human cell lines with a cytotoxic IC50 dose of ∼2 μM tris(4,7-diphenyl-1,10-phenanthroline)ruthenium(ii) chloride (RPC2) retards or arrests microtubule motion as tracked by visualizing fluorescently-tagged microtubule plus end-tracking proteins. Immunofluorescent microscopic images of the microtubules in fixed cells show substantial changes to cellular microtubule network and to overall cell morphology upon treatment with RPC2. Flow cytometry with MCF7 and H358 cells reveals only minor elevations of the number of cells in G2/M phase, suggesting that the observed cytotoxicity is not tied to mitotic arrest. In vitro studies with purified tubulin reveal that RPC2 acts to promote tubulin polymerization and when imaged by electron microscopy, these microtubules look normal in appearance. Isothermal titration calorimetry measurements show an associative binding constant of 4.8 × 106 M-1 for RPC2 to preformed microtubules and support a 1 : 1 RPC2 to tubulin dimer stoichiometry. Competition experiments show RPC2 does not compete for the taxane binding site. Consistent with this tight binding, over 80% of the ruthenium in treated cells is co-localized with the cytoskeletal proteins. These data support RPC2 acting as an in vivo microtubule stabilizing agent and sharing many similarities with cells treated with paclitaxel.

| S-EPMC8133002 | biostudies-literature

Interactions of ruthenium(II) polypyridyl complexes with human telomeric DNA.

Project description:Eight [Ru(bpy)2L]2+ and three [Ru(phen)2L]2+complexes (where bpy = 2,2'-bipyridine and phen = 1,10-phenanthroline are ancillary ligands, and L = a polypyridyl experimental ligand) were investigated for their G-quadruplex binding abilities. Fluorescence resonance energy transfer melting assays were used to screen these complexes for their ability to selectively stabilize human telomeric DNA variant, Tel22. The best G-quadruplex stabilizers were further characterized for their binding properties (binding constant and stoichiometry) using UV-vis, fluorescence spectroscopy, and mass spectrometry. The ligands' ability to alter the structure of Tel22 was determined via circular dichroism and PAGE studies. We identified me2allox as the experimental ligand capable of conferring excellent stabilizing ability and good selectivity to polypyridyl Ru(II) complexes. Replacing bpy by phen did not significantly impact interactions with Tel22, suggesting that binding involves mostly the experimental ligand. However, using a particular ancillary ligand can help fine-tune G-quadruplex-binding properties of Ru(II) complexes. Finally, the fluorescence "light switch" behavior of all Ru(II) complexes in the presence of Tel22 G-quadruplex was explored. All Ru(II) complexes displayed "light switch" properties, especially [Ru(bpy)2(diamino)]2+, [Ru(bpy)2(dppz)]2+, and [Ru(bpy)2(aap)]2+. Current work sheds light on how Ru(II) polypyridyl complexes interact with human telomeric DNA with possible application in cancer therapy or G-quadruplex sensing.

| S-EPMC10668861 | biostudies-literature

Octahedral ruthenium (II) polypyridyl complexes as antimicrobial agents against mycobacterium.

Project description:Tuberculosis is one of the world's deadliest infectious disease with 1.5 millions deaths annually. It is imperative to discover novel compounds with potent activity against M. tuberculosis. In this study, susceptibilities of M. smegmatis to the octahedral ruthenium(II) polypyridyl complexes, 1 {[(bpy)3Ru] (PF6)2 (bpy = 2,2'-bipyridine)}, 2 {[(phen)2Ru(dppz)](PF6)2 (phen = 1,10-phenanthroline, dppz = dipyridophenazine)} and 3 {[(phen)3Ru](PF6)2} were measured by broth microdilution and reported as the MIC values. Toxicities of complex 3 to LO2 and hepG2 cell lines were also measured. Complex 2 inhibited the growth of M. smegmatis with MIC value of 2 µg/mL, while complex 3 was bactericidal with MIC value of 26 µg/mL. Furthermore, the bactericidal activity of complex 3 was dependent on reactive oxygen species production. Complex 3 showed no cytotoxicity against LO2 and hepG2 cell lines at concentration as high as 64 µg/mL, paving the way for further optimization and development as a novel antibacterial agent for the treatment of M. tuberculosis infection.

| S-EPMC5410163 | biostudies-literature

Binding modes of a flexible ruthenium polypyridyl complex to DNA.

Project description:Ruthenium(II) polypyridyl complexes are attractive binders to DNA. Modifying the hydrophobicity, shape, or size of the ancillary ligands around the central ruthenium atom can induce changes in the binding mode to the DNA double helix. In this paper, we investigate the binding modes of [Ru(2,2'-bipyridine)2 (5-{4-[(pyren-1-yl)methyl]-1H-1,2,3-triazol-4-yl}-1,10-phenanthroline)]2+ (RuPy for short), a metal complex featuring a flexible pyrene moiety known for its intercalative properties. Classical molecular dynamics simulations are employed to gain insight into the non-covalent binding interactions of RuPy with two different 20 base pair DNA sequences, poly(dA)poly(dT) (AT) and poly(dC)poly(dG) (CG). In addition to examining the intercalation of the pyrene moiety from the major groove, the stability of RuPy-DNA adducts is investigated when the metal complex interacts externally with the DNA and with the major and minor groove pockets. The results indicate that external interaction and major groove binding are not stable, whereas intercalation consistently forms stable adducts. Minor groove binding showed less stability than intercalation and more variability, with some trajectories transitioning to intercalation, involving either the pyrene moiety or a bipyridine ligand. Pyrene intercalation, especially from the minor groove, was the most stable, while bipyridine intercalation was less favorable and associated with higher binding free energies.

| S-EPMC11492816 | biostudies-literature

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

Project description:The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

| S-EPMC8991003 | biostudies-literature

Ultrafast transient IR spectroscopy and DFT calculations of ruthenium(ii) polypyridyl complexes.

Project description:Ultrafast time-resolved infrared spectroscopy of [Ru(bpy)3]2+ (bpy = 2,2'-bipyridine), [Ru(mbpy)3]2+ (mbpy = 6-methyl-2,2'-bipyridine) and [Ru(mphen)3]2+ (mphen = 2-methyl-1,10'-phenanthroline) in deuterated acetonitrile serves to elucidate the evolution of the system following pulsed excitation into the 1MLCT band at 400 nm. While for [Ru(bpy)3]2+ no intermediate state can be evidenced for the relaxation of the corresponding 3MLCT state back to the ground state, for [Ru(mbpy)3]2+ and [Ru(mphen)3]2+ an intermediate state with a lifetime of about 400 ps is observed. The species associated IR difference spectra of this state are in good agreement with the calculated difference spectra of the lowest energy 3dd state using DFT. The calculated potential energy curves for all the complexes in the triplet manifold along the metal-ligand distance show that for [Ru(bpy)3]2+ the 3dd state is at a higher energy than the 3MLCT state and that there is a substantial barrier between the two minima. For [Ru(mbpy)3]2+ and [Ru(mphen)3]2+, the 3dd state is at a lower energy than the 3MLCT state.

| S-EPMC5308284 | biostudies-literature

Formin-based control of the actin cytoskeleton during cytokinesis.

Project description:Cytokinesis, the terminal event in the canonical cell cycle, physically separates daughter cells following mitosis. For cleavage to occur in many eukaryotes, a cytokinetic ring must assemble and constrict between divided genomes. Although dozens of different molecules localize to and participate within the cytokinetic ring, the core machinery comprises linear actin filaments. Accordingly, formins, which nucleate and elongate F-actin (filamentous actin) for the cytokinetic ring, are required for cytokinesis in diverse species. In the present article, we discuss specific modes of formin-based actin regulation during cell division and highlight emerging mechanisms and questions on this topic.

| S-EPMC5563852 | biostudies-other

A Mechanism Study of Redox Reactions of the Ruthenium-oxo-polypyridyl Complex.

Project description:Over the years, RuIV(bpy)2(py)(O)2+([RuIVO]2+) has garnered considerable interest owing to its extensive use as a polypyridine mono-oxygen complex. However, as the active-site Ru=O bond changes during the oxidation process, [RuIVO]2+ can be used to simulate the reactions of various high-priced metallic oxides. In order to elucidate the hydrogen element transfer process between the Ruthenium-oxo-polypyridyl complex and organic hydride donor, the current study reports on the synthesis of [RuIVO]2+, a polypyridine mono-oxygen complex, in addition to 1H and 3H (organic hydride compounds) and 1H derivative: 2. Through 1H-NMR analysis and thermodynamics- and kinetics-based assessments, we collected data on [RuIVO]2+ and two organic hydride donors and their corresponding intermediates and established a thermodynamic platform. It was confirmed that a one-step hydride transfer reaction between [RuIVO]2+ and these organic hydride donors occurs, and here, the advantages and nature of the new mechanism approach are revealed. Accordingly, these findings can considerably contribute to the better application of the compound in theoretical research and organic synthesis.

| S-EPMC10254183 | biostudies-literature

Long Noncoding RNA CRYBG3 Blocks Cytokinesis by Directly Binding G-Actin.

Project description:The dynamic interchange between monomeric globular actin (G-actin) and polymeric filamentous actin filaments (F-actin) is fundamental and essential to many cellular processes, including cytokinesis and maintenance of genomic stability. Here, we report that the long noncoding RNA LNC CRYBG3 directly binds G-actin to inhibit its polymerization and formation of contractile rings, resulting in M-phase cell arrest. Knockdown of LNC CRYBG3 in tumor cells enhanced their malignant phenotypes. Nucleotide sequence 228-237 of the full-length LNC CRYBG3 and the ser14 domain of β-actin is essential for their interaction, and mutation of either of these sites abrogated binding of LNC CRYBG3 to G-actin. Binding of LNC CRYBG3 to G-actin blocked nuclear localization of MAL, which consequently kept serum response factor (SRF) away from the promoter region of several immediate early genes, including JUNB and Arp3, which are necessary for cellular proliferation, tumor growth, adhesion, movement, and metastasis. These findings reveal a novel lncRNA-actin-MAL-SRF pathway and highlight LNC CRYBG3 as a means to block cytokinesis and to treat cancer by targeting the actin cytoskeleton.Significance: Identification of the long noncoding RNA LNC CRYBG3 as a mediator of microfilament disorganization marks it as a novel therapeutic antitumor strategy. Cancer Res; 78(16); 4563-72. ©2018 AACR.

| S-EPMC6095725 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data