Dataset Information

LncRNA linc01194 promotes the progress of endometrial carcinoma by up-regulating SOX2 through binding to IGF2BP1.

ABSTRACT:

Objective

Endometrial carcinoma (EC) is one of the most common gynecological malignant tumors. Our study showed that long non-coding RNA (lncRNA) linc01194 plays an important role in EC. We explored the mechanism of lncRNA linc01194 in EC.

Methods

The expression of lncRNA linc01194 was detected in The Cancer Genome Atlas database and starBase database. The potential targeted protein of linc01194 was predicted through the starBase database. To determine the role of linc01194 in EC, we downregulated or upregulated the level of linc01194 in EC cell lines and analyzed the cell behaviors and the changes of its potential target proteins.

Results

The expression of linc01194 in EC tissues is higher than that in normal endometrial tissues. The knockdown of linc01194 inhibited the cell proliferation, invasion and migration and promoted the apoptosis of EC cells, while overexpression of linc01194 promoted cell proliferation, invasion and migration and inhibited the apoptosis of EC cells. The starBase database revealed that linc01194 could bind to insulin-like growth factor 2 binding protein 1 (IGF2BP1). Previous results showed that in EC, IGF2BP1 could promote the expression of sex-determining region Y-box 2 (SOX2) by promoting the stability of SOX2 mRNA. Our results showed that linc01194 regulate the expression of IGF2BP1 and SOX2.

Conclusion

Linc01194 can promote the expression of downstream protein SOX2 through binding to IGF2BP1, thus promoting the occurrence and development of EC.

SUBMITTER: Huang Z

PROVIDER: S-EPMC10948988 | biostudies-literature | 2024 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

LncRNA linc01194 promotes the progress of endometrial carcinoma by up-regulating SOX2 through binding to IGF2BP1.

Huang Zhenghao Z Shen Fan F Chen Jingwen J Xie Bumin B Chen Xi X Zhao Yang Y Chen Shuo S

Journal of gynecologic oncology 20231121 2

<h4>Objective</h4>Endometrial carcinoma (EC) is one of the most common gynecological malignant tumors. Our study showed that long non-coding RNA (lncRNA) linc01194 plays an important role in EC. We explored the mechanism of lncRNA linc01194 in EC.<h4>Methods</h4>The expression of lncRNA linc01194 was detected in The Cancer Genome Atlas database and starBase database. The potential targeted protein of linc01194 was predicted through the starBase database. To determine the role of linc01194 in EC, ...[more]

PMID: 38072399

Similar Datasets

Project description:ObjectiveCalcium is present in serum mainly in filterable and bound forms, and Ca2+ is a major key to modulate signaling pathways that control oncogenesis and oncochannels associated with several types of cancer. However, the biological significance of serum calcium and its related mechanism with estrogen in endometrial cancer (EC) still remains elusive. This study aims to ascertain the relationship between serum calcium and clinicopathology in EC.MethodsRetrospective assessment of a total of 502 patients diagnosed with EC after surgery in Peking University People's Hospital from 2010 to 2018. Preoperative serum ionized calcium and the albumin corrected calcium was calculated in quartiles for various postoperative clinicopathological characteristics, logistic regression adjusted for potential confounders. Intracellular calcium homeostasis change induced by estrogen was detected by confocal analysis. Downstream pathways were analyzed by transcriptome and proteomics. Mitochondrial Ca2+ and ROS (reactive oxygen species) level was detected by confocal and flow cytometry. Lysosomal morphological and membrane changes were verified by confocal or Western blot assays.ResultsHigh level of albumin-corrected serum calcium was significantly correlated with EC clinicopathological characteristics progression include lymph vascular space invasion, lymph nodes metastasis, myometrial invasion, and cervical invasion. Calcium homeostasis regulated by estrogen in EC cells derived from extracellular calcium influx but not the release of the endoplasmic reticulum. Proteomic and bioinformatic analysis revealed the calcium influx might be involved in the regulation of autophagy and mitochondrial-related pathways. Mechanistic investigation demonstrated that calcium influx acted on the function of mitochondrial ROS and lysosomal activity.ConclusionOur findings revealed that serum calcium level was significantly related to poor outcomes. The extracellular calcium influx induced by estrogen was targeted to mitochondrial ROS and lysosome activity, which should be oriented to improve EC therapeutic strategies.

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

LncRNA linc01194 promotes the progress of endometrial carcinoma by up-regulating SOX2 through binding to IGF2BP1.

Objective

Methods

Results

Conclusion

Publications

LncRNA linc01194 promotes the progress of endometrial carcinoma by up-regulating SOX2 through binding to IGF2BP1.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets