Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

ABSTRACT: We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transpositio

SUBMITTER: Ramos-Gonzalez MI 

PROVIDER: S-EPMC1317595 | biostudies-literature | 2006 Jan

REPOSITORIES: biostudies-literature