Unknown

Dataset Information

0

5'-Terminal chemical capping of spliced leader RNAs.


ABSTRACT: Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.

SUBMITTER: Piecyk K 

PROVIDER: S-EPMC3501006 | biostudies-literature | 2012 Sep

REPOSITORIES: biostudies-literature

altmetric image

Publications

5'-Terminal chemical capping of spliced leader RNAs.

Piecyk Karolina K   Davis Richard E RE   Jankowska-Anyszka Marzena M  

Tetrahedron letters 20120704 36


Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild  ...[more]

Similar Datasets

| S-EPMC109026 | biostudies-literature
| S-EPMC2905750 | biostudies-literature
| S-EPMC8754658 | biostudies-literature
2021-09-13 | GSE171049 | GEO
| S-EPMC1838650 | biostudies-literature
| S-EPMC2606063 | biostudies-literature
| S-EPMC4664967 | biostudies-literature
| S-EPMC33275 | biostudies-literature
| S-EPMC2271357 | biostudies-literature
| S-EPMC5413853 | biostudies-literature