Ontology highlight
ABSTRACT:
SUBMITTER: Aranda J
PROVIDER: S-EPMC3889614 | biostudies-literature | 2013 Dec
REPOSITORIES: biostudies-literature

Aranda Jesús J Poza Margarita M Shingu-Vázquez Miguel M Cortés Pilar P Boyce John D JD Adler Ben B Barbé Jordi J Bou Germán G
Journal of bacteriology 20131011 24
The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in ...[more]