Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

ABSTRACT: We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAA

SUBMITTER: Suzuki O 

PROVIDER: S-EPMC4160947 | biostudies-literature | 2013

REPOSITORIES: biostudies-literature