Unknown

Dataset Information

0

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.


ABSTRACT: Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

SUBMITTER: Li J 

PROVIDER: S-EPMC5399899 | biostudies-literature | 2017 Mar

REPOSITORIES: biostudies-literature

altmetric image

Publications

Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

Li Jie J   Zhu Xichun X   Ma Lin L   Xu Hongwei H   Cao Xin X   Luo Renyun R   Chen Hong H   Sun Xiuzhu X   Cai Yong Y   Lan Xianyong X  

Prion 20170301 2


Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associati  ...[more]

Similar Datasets

| S-EPMC5105919 | biostudies-literature
| S-EPMC10177341 | biostudies-literature
| S-EPMC5871074 | biostudies-literature
| S-EPMC4617744 | biostudies-literature
| S-EPMC1925122 | biostudies-literature
| S-EPMC11769414 | biostudies-literature
| S-EPMC7197704 | biostudies-literature
| S-EPMC8784345 | biostudies-literature
| S-EPMC4596403 | biostudies-literature
| S-EPMC5057310 | biostudies-literature