Genomic Disruption of FOXL2 in Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type 2: A Novel Deletion-Insertion Compound Mutation.
Ontology highlight
ABSTRACT:
SUBMITTER: Niu BB
PROVIDER: S-EPMC6166469 | biostudies-literature | 2018 Oct
REPOSITORIES: biostudies-literature
Publications
Genomic Disruption of <i>FOXL2</i> in Blepharophimosis-Ptosis-Epicanthus Inversus Syndrome Type 2: A Novel Deletion-Insertion Compound Mutation.
Niu Bei-Bei BB Tang Ning N Xu Qin Q Chai Pei-Wei PW
Chinese medical journal 20181001 19
Similar Datasets
Project description:BackgroundBlepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare, autosomal dominant disease. There are two clinical types of BPES: type I patients have eyelid abnormalities accompanied by infertility in affected females, while type II patients only display eyelid malformations. Previous studies have reported that the forkhead box L2 (FOXL2) gene mutations cause BPES.PurposeTo identify plausible FOXL2 mutation in a Chinese family with BPES and infertility METHODS: Mutational screening of FOXL2 was performed in the affected members and 223 controls. Functional characterization of the novel mutation identified was carried out in vitro by luciferase reporter assay and subcellular localization experiment.ResultsA novel heterozygous mutation c.188 T > A (p.I63N) in FOXL2 was identified in two BPES patients in this family. The mutation abolished the transcriptional repression of FOXL2 on the promoters of CYP19A1 and CCND2 genes, as shown by luciferase reporter assays. However, no dominant-negative effect was observed for the mutation, and it did not impact FOXL2 protein nuclear localization and distribution.ConclusionsThe mutation c.188 T > A (p.I63N) in FOXL2 might be causative for BPES and infertility in this family and further amplified the spectrum of FOXL2 mutations.
| S-EPMC7000634 | biostudies-literature
Project description:Blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) is a rare autosomal dominant genetic disease characterized by a narrowed horizontal palpehral aperture, ptosis, epicanthus inversus and telecanthus with or without premature ovarian failure. Mutations in the forkhead transcription factor 2 (FOXL2) have been shown to be responsible for BPES. We performed direct sequencing of the FOXL2 gene for molecular investigation of a Chinese family with BPES. A novel duplication mutation (c.858_868dup), resulting in a truncated protein, was detected.
| S-EPMC4785579 | biostudies-literature
Project description:PurposeBlepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant disorder where eyelid malformation associated with (type I) or without (type II) premature ovarian failure (POF). It is ascribed to mutations in the forkhead transcriptional factor2 (FOXL2) gene. The purpose of this study is to identify mutations in FOXL2 of Chinese patients with BPES.MethodsGenomic DNA was prepared from leucocytes of peripheral venous blood. The coding regions and nearby intron sequences of FOXL2 were analyzed by cycle and cloning sequencing.ResultsFour mutations in FOXL2 were identified in six families, including c.241T>C, c.650C>G, c.804dupC, and c.672_701dup. Of the four, the c.241T>C and c.650C>G were novel and would result in missense changes of the encoded proteins, i.e., p.Tyr81His and p.Ser217Cys, respectively. The c.672_701dup (p.Ala224_Ala234dup) was detected in three families, indicating a mutation hotspot. The c.804dupC (p.Gly269ArgfsX265) mutation was found in one family.ConclusionsOur results expand the spectrum of FOXL2 mutations and confirm the mutation hotspot in FOXL2.
| S-EPMC2533039 | biostudies-literature
Project description:BackgroundBlepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare autosomal dominant disease. Mutations in the forkhead box L2 (FOXL2) gene cause two types of BPES distinguished by the presence (type I) and absence (type II) of premature ovarian failure (POF). The purpose of this study was to identify possible mutations in FOXL2 in two Chinese families with BPES.MethodsTwo large autosomal dominant Chinese BPES families were enrolled in this study. Genomic DNA was obtained from the leukocytes in peripheral venous blood. Four overlapping sets of primers were used to amplify the entire coding region and nearby intron sequences of the FOXL2 gene for mutations detection using polymerase chain reaction (PCR) and sequencing analyses. The sequencing results were analyzed using DNAstar software.ResultsAll patients of the two families demonstrated typical features of BPES type II, including small palpebral fissures, ptosis, telecanthus, and epicanthus inversus without female infertility (POF). A novel FOXL2 heterozygous indel mutation c.675_690delinsT, including a 16-bp deletion and a 1-bp(T) insertion (p.Ala226_Ala230del), which would result in deletion of 5 alanine residues of a poly-alanine (poly-Ala) tract in the protein, was identified in all affected members of family A. A novel heterozygous missense mutation (c.223C > T, p.Leu75Phe) was identified in family B.ConclusionsTwo novel FOXL2 mutations were identified in Chinese families with BPES. Our results expand the spectrum of FOXL2 mutations and provide additional structure-function insights into the FOXL2 protein.
| S-EPMC4593235 | biostudies-literature
Project description:BackgroundBlepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a malformation of the eyelids. Forkhead Box L2 (FOXL2) is the only gene known to be associated with BPES.MethodsWe identified two Han Chinese BPES families with premature ovarian insufficiency (POI). Sanger sequencing and in vitro functional analysis were performed to identify the genetic cause.ResultsSanger sequencing identified two novel mutations (c.462_468del, c.988_989insG) in FOXL2, one in each family. The in vitro functional analysis confirmed that both novel mutations were associated with impaired transactivation of downstream genes. Specifically, the single-base insertion, c.988_989insG, led to subcellular mislocalization and aggregation of the encoded protein, which validated the hypothesis that the two novel FOXL2 mutations are deleterious and associated with POI in the two BPES families.ConclusionThe novel mutations identified in the present study will enhance the present knowledge of the mutation spectrum of FOXL2. The in vitro experiments provide further insights into the molecular mechanism by which the two new variants mediate disease pathogenesis and may contribute to elucidating the genotype-phenotype correlation between the two novel FOXL2 mutations and POI.
| S-EPMC5902393 | biostudies-literature
Project description:AimTo characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES).MethodsThirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations.ResultsAll patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein.ConclusionA novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.
| S-EPMC8025160 | biostudies-literature
Project description:The blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is a rare autosomal dominant disease mainly caused by FOXL2 variants. This genetic disorder is usually characterized by eyelid malformation and ovarian dysfunction. However, no reliable genotype/phenotype correlations have been established considering the ovarian phenotype. Here, we detected 15 FOXL2 variants including nine novel ones from 7 families and 8 sporadic cases, which expanded the spectrum of FOXL2 variants and identified a potential clinical cause. Functional studies, with respect to the effect of FOXL2 on the StAR promoter, showed that non-sense variants that lead to protein truncation before the polyalanine tract and missense variants [c.307C > T; p.(Arg103Cys), c.311A > C; p.(His104Pro), c.320G > A; p.(Ser107Asn), and c.335T > A; p.(Phe112Tyr)] within the central portion of the FOXL2 forkhead domain significantly affect its suppressor activity. Such changes may explain the mechanism underlying a more severe phenotype, more likely to result in BPES type I. Furthermore, the missenses variants c.307C > T; p.(Arg103Cys), c.311A > C; p.(His104Pro), and c.320G > A; p.(Ser107Asn) were not able to transactivate OSR2, which is consistent with the eyelid malformation in these patients. The results from our cohort have expanded the spectrum of FOXL2 variants and have provided insights into genotype/phenotype correlations.
| S-EPMC8007913 | biostudies-literature
Project description:Background: Blepharophimosis-ptosis-epicanthus inversus syndrome (BPES) is an autosomal dominant disease with a low incidence rate. Indel mutations in the forkhead box L2 (FOXL2) gene cause two types of BPES that are distinguished by the presence (type I) or absence (type II) of premature ovarian failure (POF). The purpose of this study was to identify a possible deletion in FOXL2 in Chinese families with BPES and to clarify its relationship with POF. Methods: An autosomal dominant Chinese BPES family with four generations was enrolled in this study. Peripheral venous blood was collected from all affected patients, and genomic DNA was extracted from leukocytes. The whole coding sequence and nearby 5' untranslated region (UTR) and 3'UTR of the FOXL2 gene were amplified using polymerase chain reaction (PCR) with three sets of overlapping primers, followed by sequencing analyses. The sequencing results were analysed using SeqMan software. Based on the patients' clinical manifestations and analysis of the identified indel mutation, we found that the mutation disturbed interactions between FOXL2 and the StAR gene. Furthermore, through subcellular localisation and functional studies, we observed significant mislocalisation of the mutant protein; the mutant protein was found in the cytoplasm, while the wild-type protein was found in the nucleus. Loss of function was confirmed by transcriptional activity assays, quantitative real-time PCR, and electrophoretic mobility shift assays. Results: All affected patients presented with clinical features of BPES type I, including small palpebral fissures, ptosis, telecanthus, and epicanthus inversus with POF. A novel FOXL2 heterozygous indel mutation, c.19_95del, a 77-bp deletion that disrupts FOXL2 protein structure, was identified in all affected members of the family. In addition, this indel mutation significantly increased StAR mRNA expression by disrupting the ability of the FOXL2 protein to bind to the StAR promoter and act as a repressor of this gene. Conclusions: A novel FOXL2 indel mutation was identified in Chinese families with BPES. Our results expand the spectrum of known FOXL2 mutations and provide additional insight into the structure-function relationships of the FOXL2 protein. Furthermore, this novel mutation resulted in the dysfunction of FOXL2 as a transcription factor, blocking its ability to bind to the promoter region of the StAR gene, resulting in POF in the affected patient.
| S-EPMC5599907 | biostudies-literature
Project description:Blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES) is a craniofacial disorder caused by heterozygous variants of the forkhead box L2 (FOXL2) gene. It shows autosomal dominant inheritance but can also occur sporadically. Depending on the mutation, two phenotypic subtypes have been described, both involving the same craniofacial features: type I, which is associated with premature ovarian failure (POF), and type II, which has no systemic features. The genotype-phenotype correlation is not fully understood, but it has been hypothesised that type I BPES involves more severe loss of function variants spanning the whole gene. Type II BPES has been linked to frameshift mutations that result in elongation of the protein rather than complete loss of function. A mutational hotspot has been identified within the poly-alanine domain, although the exact function of this region is still unknown. However, the BPES subtype cannot be determined genetically, necessitating informed genetic counselling and careful discussion of family planning advice in view of the associated POF particularly as the patient may still be a child. Following puberty, female patients should be referred for ovarian reserve and response assessment. Oculofacial features can be managed with surgical intervention and regular monitoring to prevent amblyopia.
| S-EPMC7998575 | biostudies-literature
Project description:Introduction: Blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES) is a rare inherited disorder. This study was aimed to identify and functionally validate FOXL2 variants in two Chinese families with BPES. Methods: The proband and his family members were subjected to whole-exome sequencing to identify disease-associated variants. Several bioinformatic tools were used to computationally predict altered proteins. In vitro functional assays were conducted by transfecting wild-type and mutant FOXL2 cDNAs into HEK-293 cells, followed by subcellular localization assays, luciferase reporter gene assays, and quantitative real-time polymerase chain reaction. Results: The clinical features of BPES, including small palpebral fissures, ptosis, telecanthus, and epicanthus inversus, were present in all affected patients. Two novel mutations were detected, c.292T>A and c.383G>T. Whole-exome sequencing analysis and prediction software suggested that these mutations were pathogenic. Functional studies showed that these two point mutations decreased FOXL2 protein expression, resulting in subcellular mislocalization and aberrant transcriptional activity of the steroidogenic acute regulatory protein gene promoter. Conclusion: Our results add to the current understanding of known FOXL2 variants in, and our in vitro experiments provide reference data and insights into the etiology of BPES. Further studies are needed to identify the possible mechanisms underlying the action of this mutation on the development of BPES.
| S-EPMC10894958 | biostudies-literature