Ontology highlight
ABSTRACT:
SUBMITTER: Cui X
PROVIDER: S-EPMC6408435 | biostudies-literature | 2019 Mar
REPOSITORIES: biostudies-literature

Cui Xiaojie X Chen Han H Zhang Qiang Q Xu Ming M Yuan Gu G Zhou Jiang J
Scientific reports 20190308 1
G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further eviden ...[more]