Targeted next generation sequencing revealed a novel deletion-frameshift mutation of KCNH2 gene in a Chinese Han family with long QT syndrome: A case report and review of Chinese cases.

ABSTRACT:

Introduction

Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2.

Patient concerns

A Chinese Han family with LQTS phenotypes was examined.

Diagnosis

A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGA

SUBMITTER: Du F 

PROVIDER: S-EPMC7220270 | biostudies-literature | 2020 Apr

REPOSITORIES: biostudies-literature