Reconvalescent plasma/camostat mesylate in early SARS-CoV-2 Q-PCR positive high-risk individuals (RES-Q-HR): a structured summary of a study protocol for a randomized controlled trial.
Ontology highlight
ABSTRACT:
SUBMITTER: Keitel V
PROVIDER: S-EPMC8127198 | biostudies-literature | 2021 May
REPOSITORIES: biostudies-literature
Publications
Reconvalescent plasma/camostat mesylate in early SARS-CoV-2 Q-PCR positive high-risk individuals (RES-Q-HR): a structured summary of a study protocol for a randomized controlled trial.
Keitel Verena V Jensen Björn B Feldt Torsten T Fischer Johannes C JC Bode Johannes G JG Matuschek Christiane C Bölke Edwin E Budach Wilfried W Plettenberg Christian C Scheckenbach Kathrin K Kindgen-Milles Detlef D Timm Jörg J Müller Lisa L Kolbe Henrike H Stöhr Andreas A Calles Christian C Hippe Andreas A Verde Pablo P Spinner Christoph D CD Schneider Jochen J Wolf Timo T Kern Winfried V WV Nattermann Jacob J Zoufaly Alexander A Ohmann Christian C Luedde Tom T
Trials 20210517 1
<h4>Objectives</h4>Currently, there are no approved treatments for early disease stages of COVID-19 and few strategies to prevent disease progression after infection with SARS-CoV-2. The objective of this study is to evaluate the safety and efficacy of convalescent plasma (CP) or camostat mesylate administered within 72 h of diagnosis of SARS-CoV-2 infection in adult individuals with pre-existing risk factors at higher risk of getting seriously ill with COVID-19. Camostat mesylate acts as an inh ...[more]
Similar Datasets
Project description: Not available
| S-EPMC8041240 | biostudies-literature
Project description:Severe acute respiratory syndrome coronavirus 2 cell entry depends on angiotensin-converting enzyme 2 and transmembrane serine protease 2 and is blocked in cell culture by camostat mesylate, a clinically proven protease inhibitor. Whether camostat mesylate is able to lower disease burden in coronavirus disease 2019 sepsis is currently unknown.DesignRetrospective observational case series.SettingPatient treated in ICU of University hospital Göttingen, Germany.PatientsEleven critical ill coronavirus disease 2019 patients with organ failure were treated in ICU.InterventionsCompassionate use of camostat mesylate (six patients, camostat group) or hydroxychloroquine (five patients, hydroxychloroquine group).Measurements and main resultsClinical courses were assessed by Sepsis-related Organ Failure Assessment score at days 1, 3, and 8. Further, viral load, oxygenation, and inflammatory markers were determined. Sepsis-related Organ Failure Assessment score was comparable between camostat and hydroxychloroquine groups upon ICU admission. During observation, the Sepsis-related Organ Failure Assessment score decreased in the camostat group but remained elevated in the hydroxychloroquine group. The decline in disease severity in camostat mesylate treated patients was paralleled by a decline in inflammatory markers and improvement of oxygenation.ConclusionsThe severity of coronavirus disease 2019 decreased upon camostat mesylate treatment within a period of 8 days and a similar effect was not observed in patients receiving hydroxychloroquine. Camostat mesylate thus warrants further evaluation within randomized clinical trials.
| S-EPMC7671878 | biostudies-literature
Project description:Camostat mesylate is expected to be promising as a treatment option for COVID-19, in addition to other indications for which it is currently used. Furthermore, in vitro experiments have confirmed the potential of camostat and its metabolites to be effective against COVID-19. Therefore, clinical trials were conducted to evaluate the safety and pharmacokinetic characteristics of camostat after single-dose administration. Additionally, we aim to predict the pharmacokinetics of repeated dosing through modeling and simulation based on clinical trials. Clinical trials were conducted on healthy Korean adults, and an analysis was carried out of the metabolites of camostat, GBPA, and GBA. Pharmacokinetic modeling and simulation were performed using Monolix. There were no safety issues (AEs, physical examinations, clinical laboratory tests, vital sign measurements, and ECG) during the clinical trial. The pharmacokinetic characteristics at various doses were identified. It was confirmed that AUC last and Cmax increased in proportion to dose in both GBPA and GBA, and linearity was also confirmed in log-transformed power model regression. Additionally, the accumulation index was predicted (1.12 and 1.08 for GBPA and GBA). The pharmacokinetics of camostat for various dose administrations and indications can be predicted prior to clinical trials using the developed camostat model. Furthermore, it can be used for various indications by connecting it with pharmacodynamic information.
| S-EPMC10534584 | biostudies-literature
Project description:The SARS-CoV-2 coronavirus, which causes COVID-19, uses a viral surface spike protein for host cell entry and the human cell-surface transmembrane serine protease, TMPRSS2, to process the spike protein. Camostat mesylate, an orally available and clinically used serine protease inhibitor, inhibits TMPRSS2, supporting clinical trials to investigate its use in COVID-19. A one-compartment pharmacokinetic (PK)/pharmacodynamic (PD) model for camostat and the active metabolite FOY-251 was developed, incorporating TMPRSS2 reversible covalent inhibition by FOY-251, and empirical equations linking TMPRSS2 inhibition of SARS-CoV-2 cell entry. The model predicts that 95% inhibition of TMPRSS2 is required for 50% inhibition of viral entry efficiency. For camostat 200 mg dosed four times daily, 90% inhibition of TMPRSS2 is predicted to occur but with only about 40% viral entry inhibition. For 3-fold higher camostat dosing, marginal improvement of viral entry rate inhibition, up to 54%, is predicted. Because respiratory tract viral load may be associated with negative outcome, even modestly reducing viral entry and respiratory tract viral load may reduce disease progression. This modeling also supports medicinal chemistry approaches to enhancing PK/PD and potency of the camostat molecule. IMPORTANCE Strategies to repurpose already-approved drugs for the treatment of COVID-19 has been attractive since the beginning of the pandemic. Camostat mesylate, a serine protease inhibitor approved in Japan for the treatment of acute exacerbations of chronic pancreatitis, inhibits TMPRSS1, a host cell surface serine protease essential for SARS-CoV-2 viral entry. In vitro experiments provided data suggesting that camostat might be effective in the treatment of COVID-19. Multiple clinical trials were planned to test the hypothesis that camostat would be beneficial for treating COVID-19 (for example, clinicaltrials.gov, NCT04353284). The present work used a one-compartment pharmacokinetic (PK)/pharmacodynamic (PD) mathematical model for camostat and the active metabolite FOY-251, incorporating TMPRSS2 reversible covalent inhibition by FOY-251, and empirical equations linking TMPRSS2 inhibition of SARS-CoV-2 cell entry. This work is valuable to guide further development of camostat mesylate and possible medicinal chemistry derivatives for the treatment of COVID-19.
| S-EPMC9047529 | biostudies-literature
Project description:Antiviral therapy is urgently needed to combat the coronavirus disease 2019 (COVID-19) pandemic, which is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The protease inhibitor camostat mesylate inhibits SARS-CoV-2 infection of lung cells by blocking the virus-activating host cell protease TMPRSS2. Camostat mesylate has been approved for treatment of pancreatitis in Japan and is currently being repurposed for COVID-19 treatment. However, potential mechanisms of viral resistance as well as camostat mesylate metabolization and antiviral activity of metabolites are unclear. Here, we show that SARS-CoV-2 can employ TMPRSS2-related host cell proteases for activation and that several of them are expressed in viral target cells. However, entry mediated by these proteases was blocked by camostat mesylate. The camostat metabolite GBPA inhibited the activity of recombinant TMPRSS2 with reduced efficiency as compared to camostat mesylate and was rapidly generated in the presence of serum. Importantly, the infection experiments in which camostat mesylate was identified as a SARS-CoV-2 inhibitor involved preincubation of target cells with camostat mesylate in the presence of serum for 2 h and thus allowed conversion of camostat mesylate into GBPA. Indeed, when the antiviral activities of GBPA and camostat mesylate were compared in this setting, no major differences were identified. Our results indicate that use of TMPRSS2-related proteases for entry into target cells will not render SARS-CoV-2 camostat mesylate resistant. Moreover, the present and previous findings suggest that the peak concentrations of GBPA established after the clinically approved camostat mesylate dose (600 mg/day) will result in antiviral activity.
| S-EPMC7418737 | biostudies-literature
Project description:BackgroundAntivirals are needed to combat the COVID-19 pandemic, which is caused by SARS-CoV-2. The clinically-proven protease inhibitor Camostat mesylate inhibits SARS-CoV-2 infection by blocking the virus-activating host cell protease TMPRSS2. However, antiviral activity of Camostat mesylate metabolites and potential viral resistance have not been analyzed. Moreover, antiviral activity of Camostat mesylate in human lung tissue remains to be demonstrated.MethodsWe used recombinant TMPRSS2, reporter particles bearing the spike protein of SARS-CoV-2 or authentic SARS-CoV-2 to assess inhibition of TMPRSS2 and viral entry, respectively, by Camostat mesylate and its metabolite GBPA.FindingsWe show that several TMPRSS2-related proteases activate SARS-CoV-2 and that two, TMPRSS11D and TMPRSS13, are robustly expressed in the upper respiratory tract. However, entry mediated by these proteases was blocked by Camostat mesylate. The Camostat metabolite GBPA inhibited recombinant TMPRSS2 with reduced efficiency as compared to Camostat mesylate. In contrast, both inhibitors exhibited similar antiviral activity and this correlated with the rapid conversion of Camostat mesylate into GBPA in the presence of serum. Finally, Camostat mesylate and GBPA blocked SARS-CoV-2 spread in human lung tissue ex vivo and the related protease inhibitor Nafamostat mesylate exerted augmented antiviral activity.InterpretationOur results suggest that SARS-CoV-2 can use TMPRSS2 and closely related proteases for spread in the upper respiratory tract and that spread in the human lung can be blocked by Camostat mesylate and its metabolite GBPA.FundingNIH, Damon Runyon Foundation, ACS, NYCT, DFG, EU, Berlin Mathematics center MATH+, BMBF, Lower Saxony, Lundbeck Foundation, Novo Nordisk Foundation.
| S-EPMC7930809 | biostudies-literature
Project description:BackgroundCamostat mesylate, an oral serine protease inhibitor, is a powerful TMPRSS2 inhibitor and has been reported as a possible antiviral treatment against COVID-19. Therefore, we aim to assess the safety and efficacy of camostat mesylate for COVID-19 treatment.MethodsA systematic review and meta-analysis synthesizing randomized controlled trials from PubMed, Scopus, Embase, Cochrane, Web of Science, clinical trials.gov, and medrxiv until June 2023. The outcomes were pooled using Mean difference (MD) for continuous outcomes and risk ratio (RR) for dichotomous outcomes. The protocol is registered in PROSPERO with ID CRD42023439633.ResultsNine RCTs, including 1,623 patients, were included in this analysis. There was no difference between camostat mesylate and placebo in producing negative PCR test results at 1-7 days (RR: 0.76, 95% CI: [0.54, 1.06] P = 0.1), 8-14 days (RR: 1.02, 95% CI: [0.84, 1.23] P = 0.87), or 15-21 days (RR: 0.99, 95% CI: [0.82, 1.19] P = 0.90); clinical resolution of symptoms at 1-7 days (RR: 0.94 (95% CI: 0.58, 1.53) P = 0.81), 8-14 days (RR: 0.91, 95% CI: [0.74, 1.11] P = 0.33, ), or 15-21 days (RR: 0.77, 95% CI: [0.40, 1.51] P = 0.45); and time to symptom improvement (MD:-0.38 weeks (95% CI: [-1.42, 0.66] P = 0.47, I2 = 85%).ConclusionCamostat mesylate did not improve clinical outcomes in patients with COVID-19, compared to placebo.
| S-EPMC11264738 | biostudies-literature
Project description:We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.
| S-EPMC4160947 | biostudies-literature
Project description:Background: To date, no oral antiviral drug has proven to be beneficial in hospitalized patients with COVID-19. Methods: In this randomized, controlled, open-label, platform trial, we randomly assigned patients ≥18 years hospitalized with COVID-19 pneumonia to receive either camostat mesylate (CM) (considered standard-of-care) or lopinavir/ritonavir (LPV/RTV). The primary endpoint was time to sustained clinical improvement (≥48 h) of at least one point on the 7-category WHO scale. Secondary endpoints included length of stay (LOS), need for mechanical ventilation (MV) or death, and 29-day mortality. Results: 201 patients were included in the study (101 CM and 100 LPV/RTV) between 20 April 2020 and 14 May 2021. Mean age was 58.7 years, and 67% were male. The median time from symptom onset to randomization was 7 days (IQR 5-9). Patients in the CM group had a significantly shorter time to sustained clinical improvement (HR = 0.67, 95%-CI 0.49-0.90; 9 vs. 11 days, p = 0.008) and demonstrated less progression to MV or death [6/101 (5.9%) vs. 15/100 (15%), p = 0.036] and a shorter LOS (12 vs. 14 days, p = 0.023). A statistically nonsignificant trend toward a lower 29-day mortality in the CM group than the LPV/RTV group [2/101 (2%) vs. 7/100 (7%), p = 0.089] was observed. Conclusion: In patients hospitalized for COVID-19, the use of CM was associated with shorter time to clinical improvement, reduced need for MV or death, and shorter LOS than the use of LPV/RTV. Furthermore, research is needed to confirm the efficacy of CM in larger placebo-controlled trials. Systematic Review Registration: [https://clinicaltrials.gov/ct2/show/NCT04351724, https://www.clinicaltrialsregister.eu/ctr-search/trial/2020-001302-30/AT], identifier [NCT04351724, EUDRACT-NR: 2020-001302-30].
| S-EPMC9354138 | biostudies-literature
Project description:ObjectivesThis study aimed to assess the efficacy and safety of 300 mg camostat mesylate three times daily in a fasted state to treat early phase COVID-19 in an ambulatory setting.MethodsWe conducted a phase II randomized controlled trial in symptomatic (maximum 5 days) and asymptomatic patients with confirmed COVID-19 infection. Patients were randomly assigned in a 2:1 ratio to receive either camostat mesylate or a placebo. Outcomes included change in nasopharyngeal viral load, time to clinical improvement, the presence of neutralizing antibodies, and safety.ResultsOf 96 participants randomized between November 2020 and June 2021, analyses were performed on the data of 90 participants who completed treatment (N = 61 camostat mesylate, N = 29 placebo). The estimated mean change in cycle threshold between day 1 and day 5 between the camostat and placebo group was 1.183 (P = 0.511). The unadjusted hazard ratio for clinical improvement in the camostat group was 0.965 (95% confidence interval, 0.480-1.942, P = 0.921 by Cox regression). The percentage distribution of the 50% neutralizing antibody titer at day 28 visit and frequency of adverse events were similar between the two groups.ConclusionUnder this protocol, camostat mesylate was not found to be effective as an antiviral drug against SARS-CoV-2.Trial registrationClinicalTrials.gov NCT04625114; November 12, 2020.
| S-EPMC9254441 | biostudies-literature