Dataset Information

Characterization of Natural and Synthetic Sialoglycans Targeting the Hemagglutinin-Neuraminidase of Mumps Virus.

ABSTRACT: The inhibition of surface viral glycoproteins offers great potential to hamper the attachment of viruses to the host cells surface and the spreading of viral infection. Mumps virus (MuV) is the etiological agent of the mumps infectious disease and causes a wide spectrum of mild to severe symptoms due to the inflammation of the salivary glands. Here we focus our attention on the hemagglutinin-neuraminidase (HN) isolated from MuV SBL-1 strain. We describe the molecular features of host sialoglycans recognition by HN protein by means of NMR, fluorescence assays and computational studies. Furthermore, we also describe the synthesis of a N-acetylneuraminic acid-derived thiotrisaccharide targeting the viral protein, and the corresponding 3D-complex. Our results provide the basis to improve the design and synthesis of potent viral hemagglutinin-neuraminidase inhibitors.

SUBMITTER: Forgione RE

PROVIDER: S-EPMC8578797 | biostudies-literature | 2021

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Characterization of Natural and Synthetic Sialoglycans Targeting the Hemagglutinin-Neuraminidase of Mumps Virus.

Forgione Rosa Ester RE Di Carluccio Cristina C Milanesi Francesco F Kubota Marie M Fabregat Nieto Ferran F Molinaro Antonio A Hashiguchi Takao T Francesconi Oscar O Marchetti Roberta R Silipo Alba A

Frontiers in chemistry 20211027

The inhibition of surface viral glycoproteins offers great potential to hamper the attachment of viruses to the host cells surface and the spreading of viral infection. Mumps virus (MuV) is the etiological agent of the mumps infectious disease and causes a wide spectrum of mild to severe symptoms due to the inflammation of the salivary glands. Here we focus our attention on the hemagglutinin-neuraminidase (HN) isolated from MuV SBL-1 strain. We describe the molecular features of host sialoglycan ...[more]

PMID: 34778199

Similar Datasets

Project description:UnlabelledA bat virus with high phylogenetic relatedness to human mumps virus (MuV) was identified recently at the nucleic acid level. We analyzed the functional activities of the hemagglutinin-neuraminidase (HN) and the fusion (F) proteins of the bat virus (batMuV) and compared them to the respective proteins of a human isolate. Transfected cells expressing the F and HN proteins of batMuV were recognized by antibodies directed against these proteins of human MuV, indicating that both viruses are serologically related. Fusion, hemadsorption, and neuraminidase activities were demonstrated for batMuV, and either bat-derived protein could substitute for its human MuV counterpart in inducing syncytium formation when coexpressed in different mammalian cell lines, including chiropteran cells. Cells expressing batMuV glycoproteins were shown to have lower neuraminidase activity. The syncytia were smaller, and they were present in lower numbers than those observed after coexpression of the corresponding glycoproteins of a clinical isolate of MuV (hMuV). The phenotypic differences in the neuraminidase and fusion activity between the glycoproteins of batMuV and hMuV are explained by differences in the expression level of the HN and F proteins of the two viruses. In the case of the F protein, analysis of chimeric proteins revealed that the signal peptide of the bat MuV fusion protein is responsible for the lower surface expression. These results indicate that the surface glycoproteins of batMuV are serologically and functionally related to those of hMuV, raising the possibility of bats as a reservoir for interspecies transmission.ImportanceThe recently described MuV-like bat virus is unique among other recently identified human-like bat-associated viruses because of its high sequence homology (approximately 90% in most genes) to its human counterpart. Although it is not known if humans can be infected by batMuV, the antigenic relatedness between the bat and human forms of the virus suggests that humans carrying neutralizing antibodies against MuV are protected from infection by batMuV. The close functional relationship between MuV and batMuV is demonstrated by cooperation of the respective HN and F proteins to induce syncytium formation in heterologous expression studies. An interesting feature of the glycoproteins of batMuV is the downregulation of the fusion activity by the signal peptide of F, which has not been reported for other paramyxoviruses. These results are important contributions for risk assessment and for a better understanding of the replication strategy of batMuV.

Project description:BackgroundNewcastle disease virus (NDV) belongs to the genus Avaluvirus and Paramyxoviridae family, and it can cause acute, highly contagious Newcastle disease in poultry. The two proteins, haemagglutinin neuraminidase (HN) and Fusion (F), are the main virulence factor of the virus and play an essential role in immunogenicity against the virus. In most paramyxoviruses, the F protein requires HN protein to fuse the membrane, and HN proteins substantially enhance the viruses' fusion activity.ResultsThe present study describes the successful cloning and expression of HN protein from NDV in Bacillus subtilis WB800 using the modified shuttle vector pHT43. HN coding sequence was cloned into the pGet II vector. It was then subcloned into the PHT43 shuttle vector and transferred to Escherichia coli for replication. The recombinant plasmid was extracted from E. coli and used to transform B. subtilis by electroporation. After induction of recombinant B. subtilis by IPTG, total cell protein and the protein secreted into the media were analysed through a time course using SDS-PAGE. The expressed HN protein was purified using cation exchange chromatography followed by metal affinity chromatography, using the 6× His epitope introduced at the carboxyl terminus of the recombinant protein. The accuracy of the PHT43-HN construct was confirmed by sequencing and enzymatic digestion. SDS-PAGE results showed that the recombinant HN protein was successfully expressed and secreted into the medium. Moreover, the purified HN protein showed neuraminidase activity with characteristics similar to the indigenous HN NDV protein. B. subtilis is a free endotoxin host that could be a favourite prokaryotic platform for producing the recombinant HN protein.ConclusionThe establishment of this expression and purification system has allowed us to explore further the biochemical characteristics of HN protein and obtain material that could be suitable for a new production of NDV candidate vaccine with high immunogenicity.

Project description:Background and aimNewcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and methodsThe HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.ResultThe data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.ConclusionLooking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Dataset Information

Characterization of Natural and Synthetic Sialoglycans Targeting the Hemagglutinin-Neuraminidase of Mumps Virus.

Publications

Characterization of Natural and Synthetic Sialoglycans Targeting the Hemagglutinin-Neuraminidase of Mumps Virus.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets