In silico approach to understand epigenetics of POTEE in ovarian cancer.

ABSTRACT: Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE struct

SUBMITTER: Qazi S 

PROVIDER: S-EPMC8709732 | biostudies-literature | 2021 Nov

REPOSITORIES: biostudies-literature