Unknown

Dataset Information

0

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.


ABSTRACT:

Background

Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.

Methods

Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation.

Results

Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy.

Conclusion

In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

SUBMITTER: Alghamdi MA 

PROVIDER: S-EPMC9367647 | biostudies-literature | 2022 Dec

REPOSITORIES: biostudies-literature

altmetric image

Publications


<h4>Background</h4>Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis.<h4>Methods</h4>Blood samples were wit  ...[more]

Similar Datasets

| S-EPMC8024648 | biostudies-literature
2022-06-09 | GSE186729 | GEO
| S-EPMC6740520 | biostudies-literature
| S-EPMC7461817 | biostudies-literature
2021-07-13 | GSE179818 | GEO
| S-EPMC10819908 | biostudies-literature
| S-EPMC3972499 | biostudies-literature
| S-EPMC7980221 | biostudies-literature