Dataset Information

A comprehensive genotype-phenotype evaluation of eight Chinese probands with Waardenburg syndrome.

ABSTRACT:

Background

Waardenburg syndrome (WS) is the most common form of syndromic deafness with phenotypic and genetic heterogeneity in the Chinese population. This study aimed to clarify the clinical characteristics and the genetic cause in eight Chinese WS families (including three familial and five sporadic cases). Further genotype-phenotype relationships were also investigated.

Methods

All probands underwent screening for the known WS-related genes including PAX3, SOX10, MITF, EDNRB, EDN3, and SNAI2 using next-generation sequencing to identify disease-causing genes. Further validation using Sanger sequencing was performed. Relevant findings for the associated genotype-phenotype from previous literature were retrospectively analyzed.

Result

Disease-causing variants were detected in all eight probands by molecular genetic analysis of the WS genes (SOX10(NM_006941.4): c.544_557del, c.553 C > T, c.762delA, c.336G > A; MITF(NM_000248.3): c.626 A > T; PAX3(NM_181459.4): c.838delG, c.452-2 A > G, c.214 A > G). Six mutations (SOX10:c.553 C > T, c.544_557del, c.762delA; PAX3: c.838delG, c.214 A > G; MITF:c.626 A > T) were first reported. Clinical evaluation revealed prominent phenotypic variability in these WS patients. Twelve WS1 cases and five WS2 cases were diagnosed in total. Two probands with SOX10 mutations developed progressive changes in iris color with age, returning from pale blue at birth to normal tan. Additionally, one proband had a renal malformation (horseshoe kidneys).All cases were first described as WS cases. Congenital inner ear malformations were more common, and semicircular malformations were exclusively observed in probands with SOX10 mutations. Unilateral hearing loss occurred more often in cases with PAX3 mutations.

Conclusion

Our findings helped illuminate the phenotypic and genotypic spectrum of WS in Chinese populations and could contribute to better genetic counseling of WS.

SUBMITTER: Li S

PROVIDER: S-EPMC9632049 | biostudies-literature | 2022 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

A comprehensive genotype-phenotype evaluation of eight Chinese probands with Waardenburg syndrome.

Li Sijun S Qin Mengyao M Mao Shuang S Mei Lingyun L Cai Xinzhang X Feng Yong Y He Chufeng C Song Jian J

BMC medical genomics 20221103 1

<h4>Background</h4>Waardenburg syndrome (WS) is the most common form of syndromic deafness with phenotypic and genetic heterogeneity in the Chinese population. This study aimed to clarify the clinical characteristics and the genetic cause in eight Chinese WS families (including three familial and five sporadic cases). Further genotype-phenotype relationships were also investigated.<h4>Methods</h4>All probands underwent screening for the known WS-related genes including PAX3, SOX10, MITF, EDNRB, ...[more]

PMID: 36329483

Similar Datasets

Project description:Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Project description:BackgroundUsher syndrome (USH) is the most common disease causing combined deafness and blindness. It is predominantly an autosomal recessive genetic disorder with occasionally digenic cases. Molecular diagnosis of USH patients is important for disease management. Few studies have tried to find the genetic cause of USH in Chinese patients. This study was designed to determine the mutation spectrum of Chinese USH patients.MethodsWe applied next generation sequencing to characterize the mutation spectrum in 67 independent Chinese families with at least one member diagnosed with USH. Blood was collected at Peking Union Medical College Hospital. This cohort is one of the largest USH cohorts reported. We utilized customized panel and whole exome sequencing, variant analysis, Sanger validation and segregation tests to find disease causing mutations in these families.ResultsWe identified biallelic disease causing mutations in known USH genes in 70 % (49) of our patients. As has been previously reported, MYO7A is the most frequently mutated gene in our USH type I patients while USH2A is the most mutated gene in our USH type II patients. In addition, we identify mutations in CLRN1, DFNB31, GPR98 and PCDH15 for the first time in Chinese USH patients. Together, mutations in CLRN1, DNFB31, GPR98 and PCDH15 account for 11.4 % of disease in our cohort. Interestingly, although the spectrum of disease genes is quite similar between our Chinese patient cohort and other patient cohorts from different (and primarily Caucasian) ethnic backgrounds, the mutations themselves are dramatically different. In particular, 76 % (52/68) of alleles found in this study have never been previously reported. Interestingly, we observed a strong enrichment for severe protein truncating mutations expected to have severe functional consequence on the protein in USH II patients compared to the reported mutation spectrum in RP patients, who often carry partial protein truncating mutations.ConclusionsOur study provides the first comprehensive genetic characterization of a large collection of Chinese USH patients. Up to 90 % of USH patients have disease caused by mutations in known USH disease genes. By combining NGS-based molecular diagnosis and patient clinical information, a more accurate diagnosis, prognosis and personalized treatment of USH patients can be achieved.

Dataset Information

A comprehensive genotype-phenotype evaluation of eight Chinese probands with Waardenburg syndrome.

Background

Methods

Result

Conclusion

Publications

A comprehensive genotype-phenotype evaluation of eight Chinese probands with Waardenburg syndrome.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets