A novel SLC5A2 heterozygous variant in a family with familial renal glucosuria.
Ontology highlight
ABSTRACT:
SUBMITTER: Hatano M
PROVIDER: S-EPMC9712647 | biostudies-literature | 2022 Dec
REPOSITORIES: biostudies-literature
Publications
A novel SLC5A2 heterozygous variant in a family with familial renal glucosuria.
Hatano Maho M Udagawa Tomohiro T Kanamori Toru T Sutani Akito A Mori Takayasu T Sohara Eisei E Uchida Shinichi S Morio Tomohiro T Nishioka Masato M
Human genome variation 20221201 1
Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal blood glucose levels in the absence of overt tubular dysfunction. SGLT2 is a sodium-glucose cotransporter expressed in the proximal tubule; loss-of-function variants in SLC5A2 are the primary cause of FRG. Heterozygous variants have rarely been reported in Japanese individuals. Here, we identified a novel SLC5A2 heterozygous variant, c.1348G>T: p.Gly450Trp, in a Japanese family comprising two children and th ...[more]
Similar Datasets
Project description:Familial renal glucosuria (FRG) is a rare condition that involves isolated glucosuria despite normal blood glucose levels. Mutations in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium‑glucose cotransporter 2 (SGLT2), have been reported to be responsible for the disease. Genetic testing of the SLC5A2 gene was conducted in a Chinese family with FRG. A number of online tools were used to predict the potential effect of the identified mutations on SGLT2 function. Additionally, the SLC5A2 mutations previously reported in PubMed were summarized. A novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene in a Chinese child with FRG was identified. In total, 86 mutations of the SLC5A2 gene have been reported to be associated with FRG. The novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene may be responsible for the onset of FRG. The present study provides a starting point for further investigation of the molecular pathogenesis of the SLC5A2 gene mutation in patients with FRG.
| S-EPMC6472135 | biostudies-literature
Project description:Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, while other impairments of tubular function are absent. Mutations in the sodium-glucose co-transporter 2 (SLC5A2) gene have been found to be responsible for FRG. However, direct evidence for the presence of SLC5A2 mutant in renal tissues is very rare. In previous studies, a non-sense mutation (c.1320 G>A:p.W440X) that would cause premature termination of the protein was found. However, the effects in the renal tissues were not reported. In the current study, a patient with FRG and a urinary glucose excretion rate of 8.3 g/day is described, for whom a novel missense mutation (c.1319G>A:p.W440X) was revealed by sequencing. Furthermore, in the immunofluorescence examination of a renal biopsy specimen, SLC5A2 was detected in the apical side of the proximal convoluted tubule, discontinuously decreased in comparison with that in normal and disease controls. The results imply that both wild-type SLC5A2 and mutant SLC5A2 with abnormal distribution were expressed in the renal tissues, and that the reduction of SLC5A2 expression and function were due to the c.1319G>A:p.W440X mutation. The current study provides valuable clues regarding the SLC5A2 molecule from genotype to phenotype in families affected by FRG.
| S-EPMC4950299 | biostudies-literature
Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.
| S-EPMC7047355 | biostudies-literature
Project description:Familial renal glycosuria (FRG) is caused by mutations in the SLC5A2 gene, which codes for Na+-glucose co-transporters 2 (SGLT2). The aim of this study was to analyze and identify the mutations in 16 patients from 8 families with FRG. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Six mutations in SLC5A2 gene were identified, including five missense mutations (c.393G > C, p.K131N; c.1003A > G, p.S335G; c.1343A > G, p.Q448R; c.1420G > C, p.A474P; c.1739G > A, p.G580D) and a 22-bp deletion in intron 7 (c.886(-10_-31)del) removing the putative branch point sequence. By the minigene studies using the pSPL3 plasmids, we confirmed that the deletion c.886(-10_-31)del acts as a splicing mutation. Furthermore, we found that this deletion causes exclusion of exon 8 in the SCL5A2 transcript in patients. The mutation c.886(-10_-31)del was present in 5 (62.5%) of 8 families, and accounts for about 37.5% of the total alleles (6/16). In conclusion, six mutations resulting in FRG were found, and the c.886(-10_-31)del may be the high frequency mutation that can be screened in FRG patients with uniallelic or negative SLC5A2 mutations.
| S-EPMC5036194 | biostudies-literature
Project description:Familial renal glucosuria (FRG) is a rare genetic condition featured by isolated glucosuria without hyperglycemia or other kidney diseases. It is caused by pathogenic mutations of the SGLT2 (Sodium-Glucose Cotransporter 2) gene, whose protein product is responsible for reabsorbing the majority of glucose in the early proximal convoluted tubule. Hitherto, quite an array of variants of SGLT2 have been identified in patients of FRG. In this study, we performed whole exome sequencing on three Chinese pediatric patients with FRG and uncovered three compound heterozygous variants of SGLT2: c.1333C > T (p.Q445X) and c.1130-5 C > G; c.1438G > T (p.V480F) and c.346G > A (p.V116M); c.1175C > G (p.S392C) and c.1333C > T (p.Q445X). Among the total of five variants, c.1333C > T (p.Q445X), c.1438G > T (p.V480F) and c.1175C > G (p.S392C) represented novel variants that had not been reported in any genetic databases. All five variants had extremely low allele frequencies and the amino acids loci affected by missense variants were highly conserved in vertebrate species. Bioinformatic tools predicted that all five variants might disrupt the function of SGLT2, which were likely to be causal for FRG in these patients. Our findings expand the variant spectrum of SGLT2 associated with FRG and provide novel insights into mechanism of action of this transporter, which will aid in the development of novel SGLT2 inhibitors for treatment of type 2 diabetes and cardiovascular diseases.
| S-EPMC9742408 | biostudies-literature
Project description:Familial renal glucosuria is a rare co-dominantly inherited benign phenotype characterized by the presence of glucose in the urine. It is caused by mutations in the SLC5A2 gene that encodes SGLT2, the Na(+)-glucose cotransporter responsible for the reabsorption of the bulk of glucose in the proximal tubule. We report a case of FRG displaying both severe glucosuria and renal hypouricaemia. We hypothesize that glucosuria can disrupt urate reabsorption in the proximal tubule, directly causing hyperuricosuria.
| S-EPMC4438413 | biostudies-literature
Project description:BackgroundFamilial renal glucosuria (FRG) is a hereditary disorder caused by variants in SLC5A2 encoding sodium-glucose cotransporter 2 (SGLT2). In this study, we aimed to characterize proximal tubule solute transport, glucagon secretion and the genotype-phenotype relationship in FRG patients.MethodsWe sequenced SLC5A2 and PDZK1IP1 in 21 FRG patients and measured the renal threshold of glucose (RTG) in 15 patients. We built an open-source online calculator of RTG, evaluated the proximal tubule transport of amino acid, uric acid and phosphate, and explored glucagon secretion after glucose ingestion in FRG patients.ResultsWe identified 12 novel SLC5A2 variants (G484D, R564W, A212S, c.574+1G>C, W649*, S592Cfs*6, Q579*, Y339*, V39F, G491E, A464E and G360D) in our cohort and yielded 111 SLC5A2 variants from literature review. RTG in our cohort ranged from 1.0 to 9.2 mmol/L. Patients with two SLC5A2 variants had lower RTG (3.9 vs 6.2 mmol/L) and higher 24-h urinary glucose excretion (24hUG) than single-variant carriers (291.0 vs 40.0 mmol/1.73 m2). Patients with homozygous missense or in-frame indels had mean 24hUG of 457.2 mmol/1.73 m2, comparable to those with homozygous truncating variants (445.0 mmol/1.73 m2) and significantly more than those with homozygous splicing variants (196.6 mmol/1.73 m2). Patients with homozygous missense variants involving conservative residues (582.0 mmol/1.73 m2) had more 24hUG than those with variants at non-conservative residues (257.6 mmol/1.73 m2). Four out of 14 tested patients had mild aminoaciduria. The RTG of FRG patients had no significant correlation to phosphate reabsorption but a potential negative correlation to the fractional excretion of uric acid. Postprandial suppression of glucagon secretion was absent in most FRG patients.ConclusionsWe built a comprehensive map showing the impact of SLC5A2 variant type and variant location on glucosuria severity. Our results highlighted the role of key residues in maintaining the transport function of SGLT2 and the functional link between glucosuria and reabsorption of amino acid and uric acid in FRG patients.
| S-EPMC10853784 | biostudies-literature
Project description:Primary renal glucosuria (PRG; OMIM #233100) is characterized by persistent glucosuria due to a reduction in the renal tubular reabsorption of glucose in the presence of a normal concentration of serum glucose and the absence of any other impairment of tubular function. The SLC5A2 gene is the causative gene, which codes for the low-affinity sodium/glucose co-transporter SGLT2. In the present study, the case of a patient with PRG associated with a novel mutation of the SLC5A2 gene is reported. The patient visited hospital for the evaluation of glucosuria in the absence of hyperglycemia, a condition that had been present for >20 years. The patient showed a fasting blood sugar level of 104 mg/dl, a 2-h postprandial sugar level of 101 mg/dl, a sodium level of 144 mmol/l, a potassium level of 3.7 mmol/l and a chloride level of 106 mmol/l in serum. Urine chemistry revealed that the amount of glucose excreted was 10.8 g/1.73 m2/24 h; however, the levels of the other parameters were unremarkable. Polymerase chain reaction (PCR) sequencing analysis of the SLC5A2 gene from the patient revealed a novel 1 bp deletion mutation, which altered the coding sequence of exon 10 in the transmembrane domain (c.1162delG; Ala388ProfsX48), suggesting an autosomal dominant inheritance pattern. This study identified a novel mutation in the SLC5A2 gene related to a benign clinical characteristic and suggests that the molecular diagnosis of the SLC5A2 gene may be useful for diagnosing renal glucosuria in patients and for deciding intervention measures for their family members.
| S-EPMC3829744 | biostudies-literature
Project description:Familial renal glycosuria is an inherited disorder resulting in glucose excretion in the urine despite normal blood glucose concentrations. It is most commonly due to mutations in the SLC5A2 gene coding for the glucose transporter SGLT2 in the proximal tubule. Several drugs have been introduced as means to lower glucose in patients with type 2 diabetes targeting SGLT2 resulting in renal glycosuria, but no studies have addressed the potential effects of decreased renal glucose reabsorption and chronic glycosuria on the prevention of glucose intolerance. Here we present data on a large pedigree with renal glycosuria due to two mutations (c.300-303+2del and p.A343V) in the SLC5A2 gene. The mutations, which in vitro affected glucose transport in a cell line model, and the ensuing glycosuria were not associated with better glycemic control during a follow-up period of more than 10 years. One individual, who was compound heterozygous for mutations in the SLC5A2 gene suffered from severe urogenital candida infections and postprandial hypoglycemia. In conclusion, in this family with familial glycosuria we did not find any evidence that chronic loss of glucose in the urine would protect from deterioration of the glucose tolerance over time.
| S-EPMC4703216 | biostudies-literature
Project description:BackgroundRenal hypouricemia is a rare heterogeneous inherited disorder characterized by impaired tubular uric acid transport, reabsorption insufficiency and /or acceleration of secretion. The affected individuals are predisposed to nephrolithiasis and recurrent episodes of exercise-induced acute kidney injury. Type 1 is caused by dysfunctional variants in the SLC22A12 gene (URAT1), while type 2 is caused by defects in the SLC2A9 gene (GLUT9). To date, more than 150 patients with the loss-of-function mutations for the SLC22A12 gene have been found (compound heterozygotes and/or homozygotes), most of whom are Japanese and Koreans.Case presentationHerein, we report a nine year old Sri Lankan boy with renal hypouricemia (serum uric acid 97 μmol/L, fractional excretion of uric acid 33%).The sequencing analysis of SLC22A12 revealed a potentially deleterious missense variant c.1400C > T (p.T467 M, rs200104135) in heterozygous state. This variant has been previously identified in homozygous and/or compound heterozygous state with other causative SLC22A12 variant c.1245_1253del (p.L415_G417del) in Roma population.ConclusionsThis is the first identification of a family with mild renal hypouricemia1 associated to the p.T467 M variant. Detailed investigations of urate blood and urine concentrations in patients with unexplained hypouricemia are needed and renal hypouricemia should also be considered in patients other than those from Japan and/or Korea. Our finding confirms an uneven geographical and ethnic distribution of Romany prevalent SLC22A12 variant that need to be considered in Asian patients (population data Genome Aggregation Database: allele frequency in South Asia 0.007055, in East Asia 0.001330).
| S-EPMC6025733 | biostudies-literature