[Corrigendum] lncRNA DQ786243 promotes hepatocellular carcinoma cell invasion and proliferation by regulating the miR‑15b‑5p/Wnt3A axis.

ABSTRACT: Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR‑15b‑5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'‑end [the sequence of this primer on p. 2, right‑hand column, line 25 should have been written as 5'‑CTTCTGCTGGGCTGTTGAGTG‑3' (with the omitted nucleotides highlighted in bold)]. Regarding the primers of miR‑15b‑5p, the authors used the mature miR‑15b‑5p sequence as the forward primer; however, they inadvertently overlooked replacing U with T in the description of the forward primer of miR‑15b‑5p, and t

SUBMITTER: Lin Z 

PROVIDER: S-EPMC9813549 | biostudies-literature | 2023 Feb

REPOSITORIES: biostudies-literature