A novel MAP3K20 mutation causing centronuclear myopathy-6 with fiber-type disproportion in a Pakistani family.
Ontology highlight
ABSTRACT:
SUBMITTER: Ahmad I
PROVIDER: S-EPMC9873553 | biostudies-literature | 2023 Feb
REPOSITORIES: biostudies-literature
Publications
A novel MAP3K20 mutation causing centronuclear myopathy-6 with fiber-type disproportion in a Pakistani family.
Ahmad Ilyas I Khan Ayaz A Noor Ul Ayan Hafiza H Budde Birgit B Altmüller Janine J Korejo Asad Aslam AA Nürnberg Gudrun G Thiele Holger H Tariq Muhmmad M Nürnberg Peter P Erdmann Jeanette J
Journal of human genetics 20221011 2
Similar Datasets
Project description:OBJECTIVES:To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
| S-EPMC5787628 | biostudies-literature
Project description:BackgroundActin, alpha, skeletal muscle 1 (ACTA1) is one of the causative genes of nemaline myopathy (NM) and congenital fiber-type disproportion (CFTD). CFTD is characterized by type 1 fiber atrophy and distinguished from NM in the absence of rods. Eight patients with CFTD, including one patient with dilated cardiomyopathy (DCM), have previously been reported. Herein, we report the case of a 10-year-old boy presenting with CFTD and DCM.MethodsWe performed exome sequencing and analyzed the effect of Met327Lys mutations on cultured C2C12 muscle cells compared with that seen in the wild type (WT, ACTA1) and previously identified Asp294Val mutations associated with a severe phenotype of CFTD without cardiomyopathy.ResultsExome sequencing revealed a de novo mutation, c.980 T > A, p.(Met327Lys), in ACTA1 (NM_001100.4). C2C12 cells transfected with the WT plasmid expressed ACTA1 in the nucleus and cytoplasm. Cells with the Asp294Val mutant showed needle-like structures in the cytoplasm, whereas the expression of the Met327Lys mutant resulted in few aggregations but many apoptotic cells.ConclusionApoptosis induced in Met327Lys-transfected muscle cells supports the pathogenicity of the mutation and can be implicated as one of the histopathological features associated with CFTD, as in NM.
| S-EPMC9482392 | biostudies-literature
Project description:BackgroundNemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder.MethodsProband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father.ResultsWe report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population.ConclusionThis novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism.
| S-EPMC5702563 | biostudies-literature
Project description:Centronuclear myopathy (CNM) is an inherited neuromuscular disorder characterised by clinical features of a congenital myopathy and centrally placed nuclei on muscle biopsy.The incidence of X-linked myotubular myopathy is estimated at 2/100000 male births but epidemiological data for other forms are not currently available.The clinical picture is highly variable. The X-linked form usually gives rise to a severe phenotype in males presenting at birth with marked weakness and hypotonia, external ophthalmoplegia and respiratory failure. Signs of antenatal onset comprise reduced foetal movements, polyhydramnios and thinning of the ribs on chest radiographs; birth asphyxia may be the present. Affected infants are often macrosomic, with length above the 90th centile and large head circumference. Testes are frequently undescended. Both autosomal-recessive (AR) and autosomal-dominant (AD) forms differ from the X-linked form regarding age at onset, severity, clinical characteristics and prognosis. In general, AD forms have a later onset and milder course than the X-linked form, and the AR form is intermediate in both respects.Mutations in the myotubularin (MTM1) gene on chromosome Xq28 have been identified in the majority of patients with the X-linked recessive form, whilst AD and AR forms have been associated with mutations in the dynamin 2 (DNM2) gene on chromosome 19p13.2 and the amphiphysin 2 (BIN1) gene on chromosome 2q14, respectively. Single cases with features of CNM have been associated with mutations in the skeletal muscle ryanodine receptor (RYR1) and the hJUMPY (MTMR14) genes.Diagnosis is based on typical histopathological findings on muscle biopsy in combination with suggestive clinical features; muscle magnetic resonance imaging may complement clinical assessment and inform genetic testing in cases with equivocal features. Genetic counselling should be offered to all patients and families in whom a diagnosis of CNM has been made.The main differential diagnoses include congenital myotonic dystrophy and other conditions with severe neonatal hypotonia.Management of CNM is mainly supportive, based on a multidisciplinary approach. Whereas the X-linked form due to MTM1 mutations is often fatal in infancy, dominant forms due to DNM2 mutations and some cases of the recessive BIN1-related form appear to be associated with an overall more favourable prognosis.
| S-EPMC2572588 | biostudies-literature
Project description:BackgroundCentronuclear myopathy (CNM), a subtype of congenital myopathy (CM), is a group of clinical and genetically heterogeneous muscle disorders. Centronuclear myopathy is a kind of disease difficult to diagnose due to its genetic diversity. Since the discovery of the SPEG gene and disease-causing variants, only a few additional patients have been reported.MethodsA radiograph test, ultrasonic test, and biochemical tests were applied to clinical diagnosis of CNM. We performed trio medical exome sequencing of the family and conservation analysis to identify variants.ResultsWe report a pair of severe CNM twins with the same novel homozygous SPEG variant c. 8710A>G (p.Thr2904Ala) identified by clinical trio medical exome sequencing of the family and conservation analysis. The twins showed clinical symptoms of facial weakness, hypotonia, arthrogryposis, strephenopodia, patent ductus arteriosus, and pulmonary arterial hypertension.ConclusionsOur report expands the clinical and molecular repertoire of CNM and enriches the variant spectrum of the SPEG gene in the Chinese population and helps us further understand the pathogenesis of CNM.
| S-EPMC7031609 | biostudies-literature
Project description:Centronuclear myopathies (CNM) describe a group of rare muscle diseases typically presenting an abnormal positioning of nuclei in muscle fibers. To date, three genes are known to be associated to a classical CNM phenotype. The X-linked neonatal form (XLCNM) is due to mutations in MTM1 and involves a severe and generalized muscle weakness at birth. The autosomal dominant form results from DNM2 mutations and has been described with early childhood and adult onset (ADCNM). Autosomal recessive centronuclear myopathy (ARCNM) is less characterized and has recently been associated to mutations in BIN1, encoding amphiphysin 2. Here we present the first clinical description of intrafamilal variability in two first-degree cousins with a novel BIN1 stop mutation. In addition to skeletal muscle defects, both patients have mild mental retardation and the more severely affected male also displays abnormal ventilation and cardiac arrhythmia, thus expanding the phenotypic spectrum of BIN1-related CNM to non skeletal muscle defects. We provide an up-to-date review of all previous cases with ARCNM and BIN1 mutations.
| S-EPMC3014877 | biostudies-literature
Project description: Not available
| S-EPMC6114030 | biostudies-literature
Project description:Mutations in DNM2 cause autosomal dominant centronuclear myopathy (ADCNM), a rare disease characterized by skeletal muscle weakness and structural anomalies of the myofibres, including nuclear centralization and mitochondrial mispositioning. Following the clinical report of a Border Collie male with exercise intolerance and histopathological hallmarks of CNM on the muscle biopsy, we identified the c.1393C>T (R465W) mutation in DNM2, corresponding to the most common ADCNM mutation in humans. In order to establish a large animal model for longitudinal and preclinical studies on the muscle disorder, we collected sperm samples from the Border Collie male and generated a dog cohort for subsequent clinical, genetic and histological investigations. Four of the five offspring carried the DNM2 mutation and showed muscle atrophy and a mildly impaired gait. Morphological examinations of transverse muscle sections revealed CNM-typical fibres with centralized nuclei and remodelling of the mitochondrial network. Overall, the DNM2-CNM dog represents a faithful animal model for the human disorder, allows the investigation of ADCNM disease progression, and constitutes a valuable complementary tool to validate innovative therapies established in mice.
| S-EPMC9016898 | biostudies-literature
Project description:BackgroundAcrocapitofemoral dysplasia (ACFD) is a rare autosomal recessive disorder, characterized by postnatal onset of disproportionate short stature with short limbs, brachydactyly, cone-shaped epiphysis, narrow thorax, and relatively large head. To date, only three homozygous missense mutations have been reported in the signaling amino terminal domain (201-308 amino acids) of the IHH gene in three ACFD families from Belgian, Dutch, and Turkish ethnicities.MethodsIn the present study, we have investigated two patients in a Pakistani family affected with ACFD. Whole exome sequencing (WES) followed by Sanger sequencing was carried out for mutational screening. The variant was further validated by in silico modeling and molecular dynamics simulation analysis.ResultsData analysis revealed a novel homozygous missense variant [c.518C>A; p.(Ala173Asp)] in exon 2 of the IHH (NM_002181.4) gene. The variant segregated within the family and was not observed in unaffected ethnically matched controls. In silico modeling and dynamic simulation analysis revealed that the variant disturbed the core structure of the domain and destabilized the loop region and the region surrounding the variant.ConclusionThis study reports the first case of ACFD from Pakistan and identifies the fourth novel missense variant in the IHH gene that led to the broadening of the phenotypic and genotypic spectrum of ACFD.
| S-EPMC11883292 | biostudies-literature
Project description:Centronuclear myopathy (CNM) is a congenital neuromuscular disorder caused by pathogenic variation in genes associated with membrane trafficking and excitation-contraction coupling (ECC). Bi-allelic autosomal-recessive mutations in striated muscle enriched protein kinase (SPEG) account for a subset of CNM patients. Previous research has been limited by the perinatal lethality of constitutive Speg knockout mice. Thus, the precise biological role of SPEG in developing skeletal muscle remains unknown. To address this issue, we generated zebrafish spega, spegb and spega;spegb (speg-DKO) mutant lines. We demonstrated that speg-DKO zebrafish faithfully recapitulate multiple phenotypes associated with CNM, including disruption of the ECC machinery, dysregulation of calcium homeostasis during ECC and impairment of muscle performance. Taking advantage of zebrafish models of multiple CNM genetic subtypes, we compared novel and known disease markers in speg-DKO with mtm1-KO and DNM2-S619L transgenic zebrafish. We observed Desmin accumulation common to all CNM subtypes, and Dnm2 upregulation in muscle of both speg-DKO and mtm1-KO zebrafish. In all, we establish a new model of SPEG-related CNM, and identify abnormalities in this model suitable for defining disease pathomechanisms and evaluating potential therapies. This article has an associated First Person interview with the joint first authors of the paper.
| S-EPMC9118044 | biostudies-literature