EGA_DEMO - samples
Ontology highlight
ABSTRACT:
PROVIDER: EGAD00001001626 | EGA |
REPOSITORIES: EGA
Similar Datasets
Project description:TSACP TruSeq Amplicon Panel dataset for the TraIT cell line use case
| EGAD00001002109 | EGA
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized system-based cell pathway analysis. The purposes of this study were to compare and analyze the expression differences of skin squamous cell line A431 in stem cells after Mir-22 deletion. Methods: mRNA profiles of control and case cells were generated by deep sequencing, in duplicate, using Illumina NovaSeq 6000. The sequence reads that passed quality filters were analyzed at the transcript isoform level with two methods:Bowtie2 to map clean reads to reference gene and use HISAT to reference genome.Bowtie2 parameters forSE reads:-q--phred64--sensitive--dpad0--gbar and HISTAparameters forSE reads:-p8--phred64--sensitive-I1-X 1000. qRT–PCR validation was performed using SYBR Green assays Results: Using an optimized data analysis workflow, we mapped about 24 million sequence reads per sample to the human genome (build hg19) and identified 17000 transcripts in control and case cells with RSEM workflow. Approximately 5% of the transcripts showed differential expression between control and case cells, with a fold change ≥1.5 and p value <0.01. Altered expression of 10 candidate genes was confirmed with qRT–PCR, demonstrating the high degree of sensitivity of the RNA-seq method.
2020-08-15 | GSE156255 | GEO
Project description:Raw data from E-MTAB-1585 was normalized by using reads per million. https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-1585/ Strand specific RNA-Seq data E-MTAB-1585 was normalized and subtracted control from knockdown to generate tracks that more clearly displayed the unusual pattern of RNA expression caused by knockdown of 7SK. The following wig files were generated from multiple samples (i.e.raw data files), as indicated in the 'readme.txt' file. 7sk_3p_KD_norm.wig: 7SK 3P Knockdown normalized 7sk_3p_KDF_norm.wig: 7SK 3P Knockdown normalized (Forward) 7sk_3p_KDR_norm.wig: 7SK 3P Knockdown normalized (Reverse) 7sk_5p_KD_norm.wig: 7SK 5P Knockdown normalized 7sk_5p_KDF_norm.wig: 7SK 5P Knockdown normalized (Forward) 7sk_5p_KDR_norm.wig: 7SK 5P Knockdown normalized (Reverse) 7sk_Control_norm.wig: 7SK Control normalized 7sk_ControlF_norm.wig: 7SK Control normalized (Forward) 7sk_ControlR_norm.wig: 7SK Control normalized (Reverse) 7sk_3p_KDF-ControlF.wig: 7SK 3P Knockdown-Control (Forward) 7sk_3p_KDR-ControlR.wig: 7SK 3P Knockdown-Control (Reverse) 7sk_5p_KDF-ControlF.wig: 7SK 5P Knockdown-Control (Forward) 7sk_5p_KDR-ControlR.wig: 7SK 5P Knockdown-Control (Reverse)
2013-09-19 | E-GEOD-50860 | biostudies-arrayexpress
Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of human feces after in vitro co-fermentation with citrus peel flavonoid extracts. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to Biomarker Bio-Tech (Beijing, China) for V3-V4 region of the 16S rDNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). A total of 8,816,250 pairs of Reads were obtained from the 112 samples sequenced, and 8,721,112 Clean Reads were generated from the double-ended Reads after quality control and splicing. The sequencing analyses were carried out using the SILVA database as a reference for the assignation of operational taxonomic units (OTUs) with 97% of identity.
2022-04-02 | GSE199749 | GEO
Project description:We present a draft genome assembly that includes 200 Gb of Illumina reads, 4 Gb of Moleculo synthetic long-reads and 108 Gb of Chicago libraries, with a final size matching the estimated genome size of 2.7 Gb, and a scaffold N50 of 4.8 Mb. We also present an alternative assembly including 27 Gb raw reads generated using the Pacific Biosciences platform. In addition, we sequenced the proteome of the same individual and RNA from three different tissue types from three other species of squid species (Onychoteuthis banksii, Dosidicus gigas, and Sthenoteuthis oualaniensis) to assist genome annotation. We annotated 33,406 protein coding genes supported by evidence and the genome completeness estimated by BUSCO reached 92%. Repetitive regions cover 49.17% of the genome.
2019-12-16 | PXD016522 | Pride
Project description:This dataset comprises of 76 cancer and normal whole genomes obtained from 11 SI-NET patients, in the form of two fastq files (forward and reverse reads) for each genome containing sequences generated by Illumina NovaSeq 6000 system.
| EGAD00001006161 | EGA
Project description:A case of transcriptional gene silencing, originally observed in tetraploid Arabidopsis plants, created an epiallele resistant to many mutations or inhibitor treatments that activate other suppressed genes. This raised the question about the molecular basis of this extreme stability. A combination of forward and reverse genetics, transcriptome profiling and drug application provides evidence for a double safeguard system that is only alleviated upon the simultaneous removal of both DNA methylation and histone methylation by loss of DDM1 or HOG1 acitivity. Three biological replicates per line are provided. C2S1 = Wt line; hog1-7=774; ddm1-12=1135
2010-02-01 | E-GEOD-17496 | biostudies-arrayexpress
Project description:We developed a high-throughput mutagenesis screen to comprehensively identify the cis-regulatory elements that control a target splicing event from the MST1R gene that codes for the RON receptor tyrosine kinase. Skipping of alternative exon 11 results in a constitutively active isoform that promotes epithelial to mesenchymal transition and thereby contributes to the invasive phenotype of tumors. First, we created a library of mutated minigenes via mutagenic PCR. Importantly, the reverse primer introduced a random barcode sequence which labels the associated mutations. Next, the plasmid library was transfected as a pool and depending on the mutations, the transcripts exhibit changes in alternative splicing. The minigene library and the splicing outcome were analyzed by next-generation sequencing and subsequent integration of the datasets resulted in a map of splicing regulatory sites. The RNA-seq experiment was performed to quantify the transcript isoforms and sequence their associated barcodes in order to characterize the splicing outcome of the minigene library in HEK293T cells. For preparation of high-throughput RNA sequencing (RNA-seq) libraries, the total RNA obtained from transfected HEK293T cells was enriched for mRNA by performing polyA selection of 20 µg of total RNA using Dynabeads® Oligo (dT)25 beads (Invitrogen) according to the manufacturer’s protocol. Reverse transcription was carried out using 500 ng of enriched mRNA under the abovementioned conditions. To prevent the formation of chimeric amplicons, the libraries were amplified using emulsion PCR (PMID: 16791213), with Phusion DNA Polymerase (NEB) and either cDNA derived from polyA-selected RNA in the case of RNA-seq or plasmid DNA of the minigene library in the case of high-throughput DNA sequencing (DNA-seq). To amplify fragments for RNA-seq, the following primers containing Illumina sequencing adaptors were used: 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTNNNNNNNNNNGTTCCACTGAAGCCTGAG-3′ (forward primer) and 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNATAGAATAGGGCCCTCTAGA-3′ (reverse primer). PCR products were purified using Agencourt AMPure XP beads (Beckman Coulter). Purified products were first analysed with the TapeStation 2200 capillary gel electrophoresis instrument (Agilent) and then fluorimetrically quantified using a Qubit fluorimeter (Thermo Scientific). Sequencing was carried out on the Illumina MiSeq platform using paired-end reads of 300 nt length and a 10% PhiX spike-in to increase sequence complexity.
2018-06-27 | E-MTAB-6216 | biostudies-arrayexpress
Project description:Capture and processing of single skin T cells from patient with mycosis fungoides was performed using the Fluidigm C1 Autoprep system. Cells were loaded at a concentration of 2,000 cells/μL onto C1 integrated fluidic circuits (IFC) chips for 5-10 μm cells. All C1 capture sites were microscopically inspected to determine the sites containing only a single cell. Empty sites and those with multiple cells were excluded from further analysis. ERCC (External RNA Controls Consortium) spike-in RNAs were added and served as a control. SMARTer Ultra Low RNA Kit (Clontech) was used for reverse transcription and cDNA preamplification. The cDNA products from each cell were then used to prepare Illumina sequencing libraries and then sequenced on Illumina HiSeq2500 using single-end 100-base reads. Gene expression was quantified using Kallisto and then normalized to TPM values
2021-08-18 | GSE179841 | GEO
Project description:Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that core promoters are unidirectional and that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that about half of promoters are unidirectional and that these unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters.
2015-01-16 | GSE63872 | GEO