Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Ena-DATASET-MCGILL-EDCC-12-01-2017-18:11:29:150-25 - samples

ABSTRACT: RNA sequencing of 31 patient-derived fibroblast cell lines from patients with inborn errors of cobalamin (vitamin B12) metabolism, and 7 control samples. The RNA seq library was prepared using the TruSeq Stranded Total RNA Sample Preparation Kit (Illumina RS-122–2301) including Ribo-Zero Gold depletion to remove ribosomal RNA. Sequencing was done via llumina Hi-Seq2000 sequencer, using 100bp paired end reads.

PROVIDER: EGAD00001003142 | EGA |

REPOSITORIES: EGA

ACCESS DATA

Json Xml

Publications

Mutations in THAP11 cause an inborn error of cobalamin metabolism and developmental abnormalities.

Quintana Anita M AM Yu Hung-Chun HC Brebner Alison A Pupavac Mihaela M Geiger Elizabeth A EA Watson Abigail A Castro Victoria L VL Cheung Warren W Chen Shu-Huang SH Watkins David D Pastinen Tomi T Skovby Flemming F Appel Bruce B Rosenblatt David S DS Shaikh Tamim H TH

Human molecular genetics 20170801 15

CblX (MIM309541) is an X-linked recessive disorder characterized by defects in cobalamin (vitamin B12) metabolism and other developmental defects. Mutations in HCFC1, a transcriptional co-regulator which interacts with multiple transcription factors, have been associated with cblX. HCFC1 regulates cobalamin metabolism via the regulation of MMACHC expression through its interaction with THAP11, a THAP domain-containing transcription factor. The HCFC1/THAP11 complex potentially regulates genes inv ...[more]

PMID: 28449119

Similar Datasets

Transcriptome profiling of mutants from the zebrafish mutation project

Project description:Total RNA was extracted from zebrafish embryos collected for one or more alleles identified by the Zebrafish Mutation Project (http://www.sanger.ac.uk/Projects/D_rerio/zmp/). The mRNA was pulled down using polyT oligos attached to magnetic beads and Illumina libraries were prepared using TruSeq Stranded mRNA SamplePreparation Kits (RS-122-2101 and RS-122-2102) according to manufacturer's instructions. For information on the proper use of pre-publication data shared by the Wellcome Trust Sanger Institute (including details of any publication moratoria), please see http://www.sanger.ac.uk/datasharing/

2015-01-08 | E-ERAD-326 | biostudies-arrayexpress

Counting and correcting errors within unique molecular identifiers to generate absolute numbers of sequencing molecules [scRNA-Seq]

Project description:Unique Molecular Identifiers (UMIs) are random oligonucleotide barcodes sequences? that are critical for the removal of PCR amplification biases within both bulk and single-cell sequencing experiments. However, the impact that PCR and sequencing errors have on the accuracy of generating absolute counts of RNA molecules is underappreciated. We demonstrate that PCR errors and not sequencing errors are the main source of inaccuracy in sequencing data and that the use of UMIs synthesized with homotrimeric nucleoside building blocks provides a solution to pinpoint and remove errors, allowing absolute counting of sequenced molecules.

2023-06-01 | GSE218901 | GEO

Counting and correcting errors within unique molecular identifiers to generate absolute numbers of sequencing molecules [RNA-seq]

2023-06-01 | GSE218899 | GEO

Revisiting the Hayflick Limit: Insights from an Integrated Analysis of Changing Transcripts, Proteins, Metabolites and Chromatin.

Project description:Replicative senescence (RS) as a model has become the central focus of research into cellular aging in vitro. Despite decades of study, this process through which cells cease dividing is not fully understood in culture, and even much less so in vivo during development and with aging. Here, we revisit Hayflick’s original observation of RS in WI-38 human fetal lung fibroblasts equipped with a battery of high dimensional modern techniques and analytical methods to deeply profile the process of RS across each aspect of the central dogma and beyond. We applied and integrated RNA-seq, proteomics, metabolomics, and ATAC-seq to a high resolution RS time course. We found that the transcriptional changes that underlie RS manifest early, gradually increase, and correspond to a concomitant global increase in accessibility in nucleolar and lamin associated domains. During RS WI-38 fibroblast gene expression patterns acquire a striking resemblance to those of myofibroblasts in a process similar to the epithelial to mesenchymal transition (EMT). This observation is supported at the transcriptional, proteomic, and metabolomic levels of cellular biology. In addition, we provide evidence suggesting that this conversion is regulated by the transcription factors YAP1/TEAD1 and the signaling molecule TGF-β2.

2022-04-04 | PXD028799 | Pride

Effect of Vitamin d Deficiency in Chronic Rhinosinusitis With Nasal Polyposis

Project description:Aim of the work 1. To determine if chronic rhinosinusitis with nasal polyps’ (CRSwNP) populations are vitamin D deficient. 2. To determine the possible anti-inflammatory effect of vitamin D supplementation (clinically & histologically). & investigate its relation to immunohistochemical tissue expression of basic fibroblast growth factor

| 2350084 | ecrin-mdr-crc

miR-122-dependent binding of TNRC6 to HCV RNA

Project description:The liver-specific microRNA, miR-122, is an essential host factor for replication of hepatitis C virus (HCV), an important infectious cause of chronic liver disease and hepatocellular carcinoma. miR-122 stabilizes the positive-strand HCV RNA genome and promotes viral RNA synthesis by binding two closely spaced sites (S1 and S2) near the 5’ end of the genome in association with Ago2. Ago2 is essential for both host factor activities, but whether other host proteins are involved is unknown. Using a quantitative proteomics approach, we identified TNRC6A (GW182) and its paralogs (TNRC6B and TNRC6C), as functionally important components of the miR-122/Ago2 host factor complex binding HCV RNA. Depletion of any two TNRC6 proteins reduced HCV replication in Huh-7.5 cells,but did not reduce viral RNA stability or translational activity, but rather dampened miR-122 stimulation of viral RNA synthesis. However, TNRC6 depletion had no effect on replication of HCV in which S2 was mutated so that miR-122 binds only S1, whereas it significantly enhanced replication when S1 was mutated and only S2 bound by miR-122. Consistent with this, we found that TNRC6 proteins preferentially associate with the S1 site, and that the association of Ago2 with S2 is increased in TNRC6-depleted cells. Collectively, these data suggest a model in which TNRC6 proteins, which are known to interact with Ago2, preferentially direct the miR-122/Ago2 complex to S1 while restricting its association with S2, thereby fine tuning the spatial organization of miR-122/Ago2 complexes bound to the viral RNA.

2019-04-24 | PXD013054 | Pride

Total RNA sequencing of IFN-stimulated and HIV-1-infected macrophages

Project description:Monocyte-derived macrophages were stimulated with 25 ng/ml of the indicated IFNs or infected with HIV-1-BaL-HSA. Total RNA was isolated 18 h following stimulation/infection using RNeasy minikit (Qiagen). Intact poly(A) RNA was purified from total RNA samples (100 to 500 ng) with oligo(dT) magnetic beads, and stranded mRNA sequencing libraries were prepared as described using the Illumina TruSeq Stranded mRNA Library Preparation kit (catalog no. RS-122-2101 and RS-122-2102). Purified libraries were qualified on an Agilent Technologies 2200 TapeStation using a D1000 ScreenTape assay (catalog no. 5067-5582 and 5067-5583). The molarity of adapter-modified molecules was defined by quantitative PCR using the Kapa Biosystems Kapa Library Quant kit (catalog no. KK4824). Individual libraries were normalized to 10 nM, and equal volumes were pooled in preparation for Illumina sequence analysis. Sequencing libraries (25 pM) were chemically denatured and applied to an Illumina HiSeq v4 single-read flow cell using an Illumina cBot system. Hybridized molecules were clonally amplified and annealed to sequencing primers with reagents from an Illumina HiSeq SR cluster kit v4-cBot (catalog no. GD-401-4001). Following transfer of the flow cell to an Illumina HiSeq 2500 instrument (HCSv2.2.38 and RTA v1.18.61), a 50-cycle single-read sequence run was performed using HiSeq SBS kit v4 sequencing reagents (catalog no. FC-401-4002).

2020-10-02 | GSE158434 | GEO

Revisiting the Hayflick Limit: Insights from an Integrated Analysis of Changing Transcripts, Proteins, Metabolites, and Chromatin

Project description:Replicative senescence (RS) as a model has become the central focus of research into cellular aging in vitro. Despite decades of study, this process through which cells cease dividing is not fully understood in culture, and even much less so in vivo during development and with aging. Here, we revisit Hayflick’s original observation of RS in WI-38 human fetal lung fibroblasts equipped with a battery of high dimensional modern techniques and analytical methods to deeply profile the process of RS across each aspect of the central dogma and beyond. We applied and integrated RNA-seq, proteomics, metabolomics, and ATAC-seq to a high resolution RS time course. We found that the transcriptional changes that underlie RS manifest early, gradually increase, and correspond to a concomitant global increase in accessibility in nucleolar and lamin associated domains. During RS WI-38 fibroblast gene expression patterns acquire a striking resemblance to those of myofibroblasts in a process similar to the epithelial to mesenchymal transition (EMT). This observation is supported at the transcriptional, proteomic, and metabolomic levels of cellular biology. In addition, we provide evidence suggesting that t s conversion is regulated by the transcription factors YAP1/TEAD1 and the signaling molecule TGF-β

2021-05-26 | GSE175533 | GEO

Project description:RS RNA-SIP

| PRJNA412932 | ENA

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data