D35967b1-2ea2-4234-9205-9981a8b4cfb4 - samples
Ontology highlight
ABSTRACT:
PROVIDER: EGAD00001006825 | EGA |
REPOSITORIES: EGA
Similar Datasets
Project description:Samples of human total RNA from different brain regions at embryonic and adult life stages, along with samples from testes (used as a control for germline piRNAs), were obtained from BioChain Institute (CA, USA) and TaKaRa Bio Inc. (CA, USA). Indexed libraries were prepared using 1 µg of total RNA and the TruSeq Small RNA Sample Prep Kit (Illumina, CA, USA), following the manufacturer’s instructions. Each library was sequenced at a concentration of 3pM for 50 cycles on the HiSeq 2500 platform (Illumina, CA, USA). The dataset presented encompasses small non-coding RNA expression profiles across various human brain regions and may be used for further studies of small RNA-related molecular mechanisms of brain function and disease.
2024-03-31 | E-MTAB-13690 | biostudies-arrayexpress
Project description:Purpose: Investigation of effects of early adversity in mice deficient for serotonin transporter on H3K4me3 enrichment in the context of differential susceptibility Methods: Following prenatal stress and behavioural screening in adulthood, 3 month old females, either wildtype or carrying a heterozygous knockout of the serotonin transporter gene, were sacrificed, brains extracted, the hippocampi of both hemispheres dissected, blended and separated in two protions. For one of these portions the material was split again in two portions, of which one was fixed using 1% PFA, and was subsequently processed using a standard Chromatin immuno precipitation protocol. Following ChIP, the samples were processed by Nxt-Dx Belgium. Library preparation was performed using the NEBNext Ultra II DNA Library prep kit for Illumina (NEB, Ipswitch, Massatchusettes, USA). Subsequently, the whole IP material was subjected to ends prep and ligation of Illumina adaptors. A clean up of the adaptor-ligated DNA with AMPure XP beads (Beckman Coulter) was performed without size selection. The eluted material was subjected to enrichment PCR (14 cycles) with the NEBNext Index primers, and a last clean up with AMPure XP beads followed. The quality of the final libraries was checked on a Bioanalyzer 2100 DNA 1000 chip (Agilent, Santa Clara, CA, USA). The concentration was determined by performing qPCR on the samples using a dilution of PhiX index3 as standard. The concentration of all indexed samples was adjusted to 10 nM and samples were pooled for sequencing. Sequencing was performed on an Illumina HiSeq4000 (read-length of 50 bp with 25-30 million reads/sample, paired-end). Results: dependent on the serotonin transporter genotype and behaviourally determined susceptibility to early life adversity, animals displayed distinct H3K4me3 enrichment. As expected, the effect sizes and significances were rather subtle. Conclusion: the epigenetic regulation by prenatal stress seems to be modulated by the serotonin transporter genotype
2024-01-27 | GSE109928 | GEO
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO
Project description:The deletion of TCF19 in CAL27,oral squamous cell carcinoma cell line,was conducted by using CRISPR/Cas9 system. For WT and TCF19 KO CAL27 cell lines, samples were done in triplicates. A total of 3μg of high-quality RNA per sample was used for ribosomal RNA removal by the Epicentre Ribo-zero rRNA Removal Kit (Epicentre, USA) and the sequencing library was prepared using the rRNA-depleted RNA by the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations. The clustering of the index-coded samples was performed on a cBot Cluster Generation System using TruSeq PE Cluster Kit v3-cBot-HS (Illumina, San Diego, CA, USA), followed by the 150-bp paired-end sequencing on the HiSeq X Ten instrument (Illumina, San Diego, CA, USA) according to the manufacturer’s protocols.
2021-01-01 | GSE153354 | GEO
Project description:The purified RNA from NFs (n=1) and KFs (n=1) treated with DMSO or ASC-J9 was used for the preparation of the sequencing library by the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s recommendations. Briefly, mRNA was purified from total RNA (1 µg) by oligo(dT)-coupled magnetic beads and fragmented into small pieces under elevated temperature. The first-strand cDNA was synthesized using reverse transcriptase and random primers. After the generation of double-strand cDNA and adenylation on the 3’ ends of DNA fragments, the adaptors were ligated and purified with the AMPure XP system (Beckman Coulter, Beverly, USA). The quality of the libraries was assessed by the Agilent Bioanalyzer 2100 system and a real-time PCR system. The qualified libraries were then sequenced on an Illumina NovaSeq 6000 platform with 150-bp paired-end reads generated by Genomics BioSci & Tech Co., Ltd.
2022-06-01 | GSE198095 | GEO
Project description:Gene expression profiling of 17 fresh frozen chondrosarcoma biopsies using the Human-6 v2 Expression BeadChip (Illumina Inc., San Diego, CA, USA). DNA copy number analyses was also performed in these tumors. Keywords: chondrosarcoma, gene expression profiling, Illumina
2009-04-01 | GSE12475 | GEO
Project description:204 placentas from three cohorts were processed for DNAme arrays in Vancouver, Canada. The three cohorts consisted of: (i) V-NORM, a normative population of term pregnancies recruited at BC Women’s Hospital (BCWH) in Vancouver, Canada (n=35), as part of a study on Epigenetics in Pregnancy Complications (EPIC); ii) V-SSRI, a population of pregnant individuals recruited in Vancouver, Canada in the 20th week of gestation (n=64), with/without clinical depression, and with/without the use of selective serotonin reuptake inhibitors (SSRIs); and (iii) QF-2011, a population of term pregnancies that were exposed to sudden-onset stress during gestation due to catastrophic flooding in the Australian state of Queensland in early January 2011 (n=105). DNA samples from all three cohorts were run on Illumina Infinium MethylationEPIC arrays in Vancouver, BC, Canada. Processing included DNA purification after extraction using the DNeasy Blood & Tissue Kit (Qiagen, Valencia, CA, USA), bisulfite conversion using the EZ DNAme Kit (Zymo Research, Orange, CA, USA), and hybridization to and processing of the Illumina Infinium MethylationEPIC BeadChip arrays according to the manufacturer’s protocol (Illumina, San Diego, CA, USA). Samples from the three cohorts were randomized and run in 3 array batches across 44 eight-sample chips as illustrated in Supp Figure 5. In the case of the V-SSRI and QF-2011 cohorts, sample exposure groups (SSRI exposed/non-exposed and objective flood stress high/low) and infant sex were carefully distributed across array chips (1-44) and rows (1-8) to minimize potential batch effects. DNAme data from raw IDAT files were read into R v4.2.2(54) and annotated with the Illumina Infinium MethylationEPIC v1.0 B4 Manifest. Several data quality control checks were undertaken using the R packages minfi(55,56), wateRmelon(57,58), and ewastools(59). First, each sample was assessed at 17 Illumina control probes to evaluate bisulfite conversion efficiency and array run quality; all samples passed the manufacturer-recommended thresholds at the control probes. Next, average total (methylated + unmethylated) fluorescence intensity was assessed between samples, and between array batches. All samples had similar total fluorescence, though samples run on the EPIC array in Batch 3 had slightly higher average intensities than those in Batch 1 and 2. Sample sex was assessed with the ewastools package(59), using the mean total fluorescence intensity (methylated + unmethylated) of the X and Y chromosome probes, normalized to the per-sample mean autosomal total fluorescence intensity, and was confirmed to match the clinically-reported sex of the infant in all cases. Sample genetic identity was assessed using the 59 SNP (‘rs’) probes on the EPIC array with the call_genotypes() and enumerate_sample_donors() functions (ewastools)(59). Finally, DNAme beta value density plots of all samples were visually assessed to determine overall similarity of the beta value distributions between samples, with no outliers identified.
2023-08-08 | GSE232778 | GEO
Project description:ATAC-seq of Col and hcr2 mutant from seedling and bud sample. Tagmentation was performed using the Tag DNA enzyme & buffer kit (Illumina, 20034210). Nextera DNA CD Index primers were used for library construction. The indexed libraries were subjected to paired-end 50-bp sequencing using an Illumina HiSeqX instrument (Microgen, Korea).
2022-03-23 | E-MTAB-10790 | biostudies-arrayexpress
Project description:Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: We chose a subset of isolates from the sequenced population of 2,101 emm28 strains that would approximately span the genetic variation present in the entire population. Fifty emm28 strains were grown in triplicate, harvested at two time points, mid-exponential (ME) and early-stationary (ES) phases of growth, and assayed in triplicate by RNA-seq. rRNA was depleted using the Ribo-Zero rRNA removal kit for Gram-positive bacteria (Illumina) and libraries were made using the ScriptSeq complete kit for bacteria (Illumina). The cDNA libraries were prepared with indexed reverse primers from the ScriptSeq Index PCR primers kit (Illumina), and purified with AMPureXP beads (Beckman Coulter).
2018-12-31 | GSE113056 | GEO
Project description:Purpose: This study aims to identify the differentially expressed genes in adult left ventricles treated with caffeine during early embryogenesis. Methods: Pregnant CD-1 mice were treated with vehicle (normal saline) or 20 mg/kg caffeine via i.p. injection once daily during embryonic day (E) 6.5-9.5. Pups were born and raised to one year of age. Left ventricles from adult male mice were dissected and used for total RNA isolation with the RNeasy Plus Mini kit (Valencia, CA, USA). mRNA was isolated from total RNA using NEXTflex™ Poly(A) Beads (Bioo Scientific, Austin, TX, USA). Sequencing libraries were prepared with the NEBNext® mRNA Library Prep Master Mix Set for Illumina (NEB, Ipswich, MA, USA) and the NEBNext Multiplex Oligos for Illumina (NEB). Illumina-adapted libraries (n=3/treatment) were pooled at equal molar ratio and sequenced with one High Output 1x75 cycles run on a NextSeq500 sequencer (Illumina, San Diego, CA, USA). The fastq files generated from RNA-Seq were uploaded to the UF Research Computing Galaxy instance developed by the University of Florida. The data were cleaned with the following steps: removed sequencing artifacts, trimmed 5’ or 3’ ends with low scores, removed adaptor contamination, and filtered low quality reads by the FastQC program. The remaining high quality RNA-Seq reads were mapped to the mouse genome (mm10) with the Tophat2 tool. Counting of RNA-Seq reads were performed with HTSeq. Differential expression (DE) of genes between treatments was analyzed using R package EdgeR, with Ensembl Mus_GRCm38.79.gtf as the reference annotation. Genes with false discovery rate (FDR) less than 0.05 and absolute fold change greater than 1.5 were considered as significant. Results: DE analysis revealed that 85 genes were up-regulated, and 31 genes were down-regulated in the adult left ventricles treated with in utero caffeine.
2017-02-09 | GSE79013 | GEO