5d671f4f-d544-42bc-ac8a-01e72911c32a - samples
Ontology highlight
ABSTRACT:
PROVIDER: EGAD00001011271 | EGA |
REPOSITORIES: EGA
Similar Datasets
Project description:We infected ZNF417 ZNF587 dKO 293T or control 293T with NL4.3 virus for 48 hours. Then genomic DNA was purified from cell lysis with by phenol chloroform. DNA was sheared into 300 bp-500 bp random fragments using Covaris Adaptive Focused Acoustics (Covaris, Woburn, MA). Sheared DNA was ligated with a linker and PCR with primers targeting HIV LTR and linker. PCR products were performed second PCR with Illumina adaptor primers. Libraries were so constructed and sequenced on Novaseq 6000.
2021-12-31 | GSE174239 | GEO
Project description:RNA from A673 cells with shRNA-mediated knockdown of GFP (4 libraries), EWS-FLI1 (4 libraries), or lnc277 (7 libraries) was isolated with TRIzol (Invitrogen). Each sample was DNase treated and further purified on an RNeasy Mini column (Qiagen) before quality analysis on an Agilent 2100 Bioanalyzer. For each sample, 100-150ng of RNA was synthesized into cDNA, sheared on a Covaris ultrasonicator, and amplified using the NuGen Encore Complete kit (NuGen) to produce strand-specific and rRNA-depleted libraries. Samples were multiplexed (4/lane) for 2x100bp paired-end sequencing on an Illumina HiSeq 2000
2014-11-01 | GSE60949 | GEO
Project description:The goal of this study is to identify genomic signatures predicitve of cell-of-origin in acute myeloid leukemia 50K bulk leukemia (GFP+) cells from the spleen of recipient mice were sorted directly into 350μl of RLT buffer (Qiagen) and flash-frozen. Total RNA was isolated according to manufacturer’s protocols (Qiagen) including DNase treatment, and quality was assessed using an Agilent 2100 Bioanalyzer and RNA 6000 Nano kit. Amplified cDNA was sheared to approximately 300bp using a Covaris E220 Focused Ultrasonicator. RNA-seq library preparation used the TruSeq DNA sample prep kit v2 (Illumina). Libraries were sequenced on the Illumina HiSeq 2000 platform.
2016-07-12 | GSE74690 | GEO
Project description:RNA from A673 cells with shRNA-mediated knockdown of GFP (4 libraries), EWS-FLI1 (4 libraries), or lnc277 (7 libraries) was isolated with TRIzol (Invitrogen). Each sample was DNase treated and further purified on an RNeasy Mini column (Qiagen) before quality analysis on an Agilent 2100 Bioanalyzer. For each sample, 100-150ng of RNA was synthesized into cDNA, sheared on a Covaris ultrasonicator, and amplified using the NuGen Encore Complete kit (NuGen) to produce strand-specific and rRNA-depleted libraries. Samples were multiplexed (4/lane) for 2x100bp paired-end sequencing on an Illumina HiSeq 2000 RNA from A673 cells with shRNA-mediated knockdown of GFP (4 libraries), EWS-FLI1 (4 libraries), or lnc277 (7 libraries) was isolated with TRIzol (Invitrogen).
2014-11-01 | E-GEOD-60949 | biostudies-arrayexpress
Project description:Acute kidney injury (AKI) is an important contributor to the development of chronic kidney disease (CKD). We performed miRNA and mRNA sequencing on biobanked human kidney tissues obtained in the routine clinical care of patients with the diagnoses of AKI and minimal change disease (MCD), in addition to nephrectomized (Ref) tissue from individuals without known kidney disease. From all renal biopsy samples, 2 cryosections (10 μM) including the entire cross-section of the tissue were placed directly into PicoPure RNA extraction buffer. RNA was isolated using the PicoPure isolation kit. Total RNA was evaluated for quantity and quality using an Agilent Bioanalyzer. Approximately 10 ng of total RNA were used for each sample’s library preparation. Ribosomal RNA was removed using RiboGone – Mammalian Kit protocol. After rRNA depletion, double-stranded cDNA was synthesized and amplified using the SMARTer Universal Low Input RNA Kit protocol. The cDNA was sheared by Covaris, and the library was prepared and barcoded following the Ion Plus Fragment Library Kit protocol. Each resulting barcoded library was quantified and quality assessed by Agilent Bioanalyzer. Multiple libraries were pooled in equal molarity. Finally, 8 μL of 100 pM pooled libraries were loaded into lanes of an Illumina HiSeq 4000. At least 30M reads per library were generated.
2024-07-11 | GSE246204 | GEO
Project description:Gestational tumour diagnosis using circulating tumour DNA
| PRJEB49976 | ENA
Project description:All sequencing was performed within the DNAlink (Korea) by using the Solexa sequencing technology (Illumina, San Diego, CA). 1 ug of genomic DNA was sheared to an average size of 150 bp by using the Covaris System. The libraries were prepared by using TruSeq DNA Sample Prep Kit (Illumina). The purified DNA library was hybridized with the SureSelect Human All Exon V3 probe set (Agilent Technologies) to capture 50 Mb of targeted exons following the manufacturer’s instructions. Exome capture was carried out using the Agilent SureSelect Human All Exon 50Mb Kit. The captured exome libraries were sequenced on the Illumina HiSeq2000 using the manufacturer’s recommended protocols.
| EGAD00001005126 | EGA
Project description:In mammals, the peptide hormone vasopressin controls renal water excretion, largely through its actions in the renal collecting duct to regulate the molecular water channel aquaporin-2 (AQP2). There are two modes of regulation: 1) short-term regulation by membrane trafficking; and 2) long-term regulation involving vasopressin-induced changes in the abundance of the aquaporin-2 protein. Defects in the long-term regulation have been implicated in multiple water balance disorders. With the objetive to identify genes that are transcriptionally regulated in response to vasopressin in cultured mouse collecting duct cells (mpkCCD), we carried out both RNA-seq to measure all transcripts (n=9) and ChIP-seq for RNA polymerase II (Polr2a) binding along the genome (n=3). Observations were made both after 24-hr treatment with the vasopressin analog dDAVP and with vehicle. Protocol:Confluent monolayers mpkCCD cells were washed in ice-cold 1X PBS (Ca+2/Mg+2-free) followed by cross-linking in 1.11% formaldehyde in Covaris Fixing Buffer (5.5 ml) for 5min at room temperature with gentle rocking (PN 520075, Covaris, Woburn, Massachusetts). Cross-linking was terminated by the addition of 0.3 ml of 1X Covaris Quenching Buffer with rocking. The buffer solution was aspirated and 1X ice-cold PBS was added to each plate. Cells were scraped into 15ml conical tubes, spun down (200 x g, 5 min), and washed twice with PBS. After the second wash, cell pellets were resuspended in 10 ml of 1X Covaris Lysis Buffer for 10 min at 4o C with rocking. Nuclei were pelleted by spinning at 1,700 x g for 5 min at 4o C. Nuclear pellets was resuspended in the 1X Covaris Wash Buffer and incubated for 10 mins at 4o C with rocking. Samples were spun at 1,700 x g for 5 min at 4o C. Nuclear pellets were washed twice with the Covaris Non-ionic Shearing Buffer and spun at 1,700 x g for 5 min at 4o C. Nuclei were resuspended in Covaris Non-ionic Shearing Buffer (Maximum of 1-3x 10^7cells per ml of buffer). Shearing. Two 20 ul aliquots of the resuspended pellets were removed prior to shearing to be used as subsequent unsheared controls for immunoblotting and agarose gel electrophoresis. The remaining samples were transferred to AFA tubes (TC12 x 12 mm) and volumes adjusted to 1 ml (V)). Samples were sheared using a Covaris S2 SonoLAB Single system for two minutes (Duty cycle: 5%; Intensity: 4; cycle: 200). Total nuclear protein concentration of each sample in mcg/ml (R) was determined with the BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). To test shearing efficiency, a 20 ul aliquot from each tube was removed after shearing to test the efficacy of shearing. The aliquots, including the unsheared sample, were incubated with 100 ul 1X TE buffer, 10 ul 10% SDS, and RNAse A (10 ug/ul, Cell Signaling Technology, Danvers, Massachusetts) for 30 mins at 37o C. 1 ul proteinase K (20 ug/ul) was added and the samples were incubated overnight at 65o C. The DNA was purified using DNA Clean & Concentrator columns (Catalog #: D4013, Zymo Research, Irvine, CA) and ran on an E-gel EX 2% agarose (Invitrogen, Carlsbad, CA). Target fragment sizes for chromatin immunoprecipitation were in the range of 150-700 bp in length with average fragment size of 300 bp. Testing epitope integrity (immunoblotting). Total protein content was determined with the BCA Protein Assay Kit (Thermo Scientific, Rockford, IL). Samples were then diluted with sample buffer (5X Laemmli buffer) at 20% (v/v) of the entire sample volume. Proteins were resolved by SDS-PAGE (4-20% polyacrylamide gels, Criterion, Bio-Rad, Hercules, CA) and transferred electrophoretically onto nitrocellulose membranes as previously described (Hwang, 2010). Membranes were probed with anti-RNA polymerase II (Catalog #: MMS-126R, Covance). The antibody was used at a 1:500 dilution (anti-RNA polymerase II) (in Odyssey blocking buffer containing 0.1% Tween 20) overnight at 4°C. After 1-h incubation with secondary antibody (Li-Cor Biosciences 680 anti-rabbit immunoglobulin G or 800 anti-mouse immunoglobulin G; Lincoln, NE) at 1:5000 dilution, sites of antibody-antigen reaction were detected using an Odyssey infrared imager (Li-Cor). Chromatin immunoprecipitation. 10 ul of sample equivalent to 2% input was removed prior to IP. Chromatin Immunoprecipitation was performed using 30-90 ug of sheared chromatin in 500 uL of 1X Covaris Non-ionic Shearing Buffer with 10 μl anti-RNA polymerase II antibodies. Samples were incubated overnight at 4°C with rotation, followed by addition of ChIP Grade Protein G Magnet Beads (Catalog #: 9006, Cell Signaling Technology) and incubation for 2 h at 4o C with rotation. The beads were washed a total of four times, including three low salt washes followed by one high salt wash for 5 mins/wash at 4o C (SimpleChIP protocol #9003, Cell Signaling Technology). Immunoprecipitated chromatin was eluted from the beads with 150 ul of 1X ChIP Elution Buffer for 30 mins at 65o C in a thermomixer. To reverse crosslinks, 6 ul of 5M NaCl and 2 ul of 20 ug/ul Proteinase K were added to the chromatin followed by incubation at 65o C overnight. DNA was purified according to SimpleChIP protocol #9003, Cell Signaling Technology. q-PCR. To check the success of the chromatin immunoprecipitation, input and ChIP’ed DNA samples were amplified with SYBR Green PCR Master Mix (Applied Biosystems) on a 7900HT Fast Real-Time PCR System. Primer sets corresponding to Hox9a and actin genes were used as positive controls for both histone and RNA polymerase II IP’s. (see Supplementary Table X for primer sequences). Library construction, amplification and sequencing. Loaded fixed volume of total eluate. Library construction was performed on a NuGEN instrument using the protocol and reagents outlined in the Ovation SP Ultralow Library Systems kit. Libraries were then enriched via PCR. After amplification, DNA was measured. A fixed amount of the total measured DNA was used for sequencing in an Illumina Hiseq2000 instrument to obtain single read data. High-throughput sequencing and read mapping. Libraries for Illumina sequencing of the samples were prepared using the the protocol and reagents outlined in the Ovation SP Ultralow Library Systems kit , NuGen Mondrian SP+ (NuGEN, San Carlos, CA) . Samples were sequenced using an Illumina HiSeq2000, obtaining 1- by 50-bp reads.
2016-07-01 | GSE79573 | GEO
Project description:To better understand FvRIF-mediated transcriptional regulation of fruit ripening, we performed DNA affinity purification sequencing (DAP-seq) to unravel FvRIF binding sites at the genome level. For DAP-seq analysis, the recombinant FvRIF fusion protein was used to purify the sheared genomic DNA of strawberry fruits. Two independent biological replicates of DAP-seq and DNA ‘input’ negative control libraries were prepared and submitted for deep sequencing.
2023-11-08 | GSE220785 | GEO
Project description:RNA-seq was carried out as described by Simone Picelli et al. with minor modifications (Genome Res 2014;24:2033-40). Briefly, RNA was extracted from 5000 cells using a miRNeasy Micro Kits (Qiagen, German). RNA quality was assessed with an Agilent RNA 6000 Pico Kit (Agilent Technologies, cat#5067-1513, USA) on an Agilent 2100 Bioanalyzer. Each library was prepared from 2ng of total RNA. After reverse transcription, cDNA was amplified for 8 cycles followed by Agencourt AMPure XP purification, the quality of cDNA library was checked on an Agilent High Sensitivity DNA Kit (Agilent Technologies, cat#5067-4626). The cDNA was sheared to a 200-500 bp size range using the Covaris AFA system. The final library was carried out by using the NEB Next ULTRA II DNA Prep Kit, and their quality and size were checked using the Agilent High Sensitivity DNA Kit. The libraries were sequenced using a Hiseq 4000 system (Illumina, USA). At least million reads were obtained for each sample. For all RNA-seq reads, we cut the 5’ adaptor (AAGCAGTGGTATCAACGCAGAGTACAT GGG) using cutadapt (version 1.10) with the parameter –e 0.17, and then aligned to the hg19 genome using OSA (version 2.10.8). The aligned data were merged and count by Samtools (version 0.1.19+), and differentially expressed genes were found based on the edgeR with default parameters (Bioinformatics 2010;26:139-40). A gene was differentially expressed if (1) p < 0.05 (2) |log2(fold change)| > 1. For hierarchical clustering, the RPKM values of differentially expressed genes were log2-transformed and standardized. 1- Pearson correlation was then used as the distance for clustering. Differentially expressed genes were selected for GO analysis using R package clusterProfiler (Omics 2012;16:284-7).
2018-12-01 | GSE117627 | GEO