Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

GMUCT sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants

ABSTRACT: In order to gain insight into relative stability of transcripts in plants that lacked m6A, we performed global mapping of uncapped and cleaved transcripts

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE108766 | GEO | 2018/11/09

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

GMUCT sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants

Project description:GMUCT sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants

| PRJNA428514 | ENA

Protein-interaction profile sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants.

Project description:In order to investigate the influence of m6A on RNA secondary-structure and RNA-protein interactions, we performed protein-interaction profile sequencing (PIP-seq)

2018-11-09 | GSE108767 | GEO

mRNA sequencing of 4 week old leaves in Arabidopsis wild type and ABI3:MTA

Project description:In order to gain insight into abundance of transcripts in the presence and absence of m6A, we performed an mRNA sequencing expirement in both mta and Col-0 plants.

2018-11-09 | GSE108764 | GEO

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

Project description:Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

| PRJNA203678 | ENA

GMUCT sequencing of 4 week old leaves in salt-treated and control Arabidopsis

Project description:In order to gain insight into stability of transcripts in the presence and absence of m6A in control and salt stress, we performed an mRNA sequencing experiment in control and salt treated plants

2018-11-09 | GSE116333 | GEO

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

2014-03-08 | GSE47121 | GEO

Improved genome-wide mapping of uncapped and cleaved transcripts in eukaryotes—GMUCT 2.0

Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.

2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress

Protein-interaction profile sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants.

Project description:Protein-interaction profile sequencing of 4 week old leaves in Arabidopsis ABI3:MTA plants.

| PRJNA428513 | ENA

RNA degradome analysis reveals substrates of NYN-domain containing DNE1 endoribonuclease in Arabidopsis

Project description:To gain insight into the functional role of DNE1 in cytoplasmic mRNA decay, we performed Parallel Analysis of RNA Ends (PARE) and Global Mapping of Uncapped and Cleaved Transcripts (GMUCT) analysis to identify DNE1-dependent cleavage sites based on their sensitivity to XRN4 within the Arabidopsis transcriptome

2023-04-25 | GSE193247 | GEO

Profiling of N6-methyladenosine (m6A) in Arabidopsis wild type and ABI3:MTA

Project description:In order to gain insight into abundance of transcripts in the presence and absence of m6A, we performed an mRNA sequencing expirement in both mta and Col-0 plants.

2018-11-09 | GSE108765 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data