Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Scleroderma and Gleevec treatment

ABSTRACT: Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design

ORGANISM(S): Homo sapiens

PROVIDER: GSE11130 | GEO | 2009/03/31

SECONDARY ACCESSION(S): PRJNA106915

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Scleroderma and Gleevec treatment

Project description:Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design Computed

2009-03-31 | E-GEOD-11130 | biostudies-arrayexpress

shld1 effect on 3T3 cell

Project description:NIH3T3 cells were cultured in medium containing 1 uM, 100 nM, 10 nM and 0 nM (serve as control) shld1 for 24 hours. Three independent cultures were obtained for each drug concentration. Total RNA from experimental samples were extracted using RNeasy Kit (Qiagen). Mouse RNA pooled from 11 cell lines (Stratagene, La Jolla, CA) was used as reference. Cy5-dUTP and Cy3-dUTP, were used to label the experimental cDNA and the reference samples, respectively, and hybridized to the Mouse Exonic Evidence Based Oligonucleotide (MEEBO) arrays (http://www.microarray.org./sfgf/meebo). The hybridizations were performed by Stanford Functional Genome Facility using its standard protocol (Oligo Array Hybridization protocol, http://www.microarray.org./sfgf/docView.do?type=2). A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Keywords: compound_treatment_design

2007-09-27 | GSE5916 | GEO

shld1 effect on 3T3 cell

2007-09-27 | E-GEOD-5916 | biostudies-arrayexpress

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).

2012-08-23 | GSE39572 | GEO

Cell cycle motif decoy oligos

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Gene expression of gastric mucosa during therapeutic acid inhibition

Project description:The effect on mucosal gene expression of potent acid inhibition with proton pump inhibitors (PPI’s) given to humans in ordinary, therapeutic doses is virtually unknown. Eight patients suffering from gastro-oesophageal reflux disease were included in this study. Endoscopic biopsies were taken from the corpus mucosa before and towards the end of a three-month treatment with the PPI esomeprazole 40 mg daily. Total RNA was extracted and samples (2 microgram total RNA) were labeled for microarray analysis. For each patient, RNA from both time points were labeled and hybridized to a single array. The gene expression patterns for 7700 genes were analyzed and differentially expressed genes were identified using one-sample Student t test. The aim of this study was, by use of cDNA microarray, to get an overview of the gene expression pattern in gastric corpus mucosa in patients after three months’ treatment with the proton pump inhibitor esomeprazole. Further characterization of the functional roles of genes whose expression is modulated by potent acid inhibition may give new insight into the molecular responses to this therapeutic intervention, including the mucosal response to the moderately increased gastrin levels encountered in clinical practice. Keywords: Repeat sample group, treatment analysis

2005-11-01 | GSE3240 | GEO

Molecular consequences of Csf1R (M-CSF receptor) inhibition by PLX3397 in the pilocarpine-induced chronic epileptic mouse hippocampus

Project description:Efficacy of Csf1R inhibition by PLX3397 compound in a mouse model of chronic epilepsy has been assessed by daily administration of either vehicle, 3 mg/kg or 30 mg/kg during 2 weeks monitoring. At the end of the study, RNA was extracted from study animals hippocampi to assess treatment consequences at the gene expression level in view of the in vivo efficacy results and the previously identified consequences of epilepsy in hyppocampus. Naive healthy mice were added separately to determine baseline expression.

2017-01-15 | GSE77578 | GEO

Effect of chronic valproic acid treatment on hepatic gene expression profile in Wfs1 knockout mouse.

Project description:Aim of the present study was to compare the effect of chronic VPA treatment in wild type and Wfs1 knockout mice on hepatic gene expression profile. Wild type, Wfs1 heterozygous and homozygous mice were treated with VPA for three months (300 mg/kg i.p. daily) and gene expression profiles in liver were evaluated using Affymetrix Mouse GeneChip 1.0 st arrays.

2014-02-20 | GSE55143 | GEO

Expression data of multiple sclerosis patients receiving glatiramer acetate therapy [U133 Plus 2.0]

Project description:The purpose of this study was to analyze the transcriptional effects induced by glatiramer acetate treatment (GA; Copaxone, 20 mg injected subcutaneously once daily) in blood monocytes of patients with relapsing-remitting form of multiple sclerosis (MS). By using Affymetrix DNA microarrays, we obtained genome-wide expression profiles of monocytes from 8 MS patients within the first two months of GA administration.

2012-12-07 | GSE42763 | GEO

mRNA abundance in HEK293T cells mock or miR-124 transfected

Project description:HEK293T cells were either mock or miR-124 transfected. Cells were lysed 12 hours after transfection with Trizol reagent. RNA was isolated, amplified, labeled (cy5), and comparatively hybridized with a universal reference (cy3) on HEEBO arrays in biological triplicate. In addition, each biological replicate was measured twice (#2's). Data from the technical replicates was averaged before analysis. SS=steady state Compound Based Treatment: miR-124

2009-11-10 | GSE18835 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data