DNA interactions with the ribosomal enhancer
Ontology highlight
ABSTRACT:
ORGANISM(S): Saccharomyces cerevisiae
PROVIDER: GSE11340 | GEO | 2009/04/08
SECONDARY ACCESSION(S): PRJNA106549
REPOSITORIES: GEO
Similar Datasets
Project description:4C-seq data was generated for regions of interest to confirm enhancer-gene promoter interactions
| EGAD00001001847 | EGA
Project description:DNA interactions with the ribosomal enhancer
| PRJNA106549 | ENA
Project description:4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes. 4C-Seq experiments from Igh and Cd83 bait in activated B cells and Tcrb (Eb) bait in double negative T cells and immature B cells. RNA-Seq and ATAC-Seq experiments in DN and Immature B cells.
2016-02-27 | E-GEOD-77645 | biostudies-arrayexpress
Project description:To determine whether a TP63/KLF5-regulated super-enhancer region can impact SREBF1 transcription, circularized chromosome conformation capture (4C) assays were performed. 4C assays identified complex, extensive interactions between the SREBF1 promoter and the super-enhancer region Moreover, these DNA-DNA contacts were strictly confined within the super-enhancer region, highlighting the specificity of chromatin interactions
2021-06-26 | GSE178923 | GEO
Project description:4C-Seq has proven to be a powerful technique to identify genome-wide interactions with a single locus of interest (or "bait") that can be important for gene regulation. However, analysis of 4C-Seq data is complicated by the many biases inherent to the technique. An important consideration when dealing with 4C-Seq data is the differences in resolution of signal across the genome that result from differences in 3D distance separation from the bait. This leads to the highest signal in the region immediately surrounding the bait and increasingly lower signals in far-cis and trans. Another important aspect of 4C-Seq experiments is the resolution, which is greatly influenced by the choice of restriction enzyme and the frequency at which it can cut the genome. Thus, it is important that a 4C-Seq analysis method is flexible enough to analyze data generated using different enzymes and to identify interactions across the entire genome. Current methods for 4C-Seq analysis only identify interactions in regions near the bait or in regions located in far-cis and trans, but no method comprehensively analyzes 4C signals of different length scales. In addition, some methods also fail in experiments where chromatin fragments are generated using frequent cutter restriction enzymes. Here, we describe 4C-ker, a Hidden-Markov Model based pipeline that identifies regions throughout the genome that interact with the 4C bait locus. In addition, we incorporate methods for the identification of differential interactions in multiple 4C-seq datasets collected from different genotypes or experimental conditions. Adaptive window sizes are used to correct for differences in signal coverage in near-bait regions, far-cis and trans chromosomes. Using several datasets, we demonstrate that 4C-ker outperforms all existing 4C-Seq pipelines in its ability to reproducibly identify interaction domains at all genomic ranges with different resolution enzymes.
2016-02-27 | GSE77645 | GEO
Project description:Using Circular chromosome conformation capture (4C) assay to uncovers epigenetically regulated intra- and inter-chromosomal interaction network To examine restrictions imposed by the nuclear structure on such cis/trans-chromosomal networks, we developed a high-throughput screening assay 4C and identified 114 different sequences from all autosomes in mouse liver cells. To check the relative frequencies of interactions, the 114 sequences were PCR amplified and spotted on glass to make dedicated microarray. The microarray and 3C validation showed that most of the sequences interact with primarily the maternally inherited H19 imprinting control region (ICR). The epigenetic feature of these interactions was highlighted by the observation that 19% of 4C library sequences are derived from 11 different imprinted domains. In some of these instances, differentially methylated regions (DMRs) interact both in cis and in trans. Moreover, the patterns of chromosomal interactions undergo reprogramming during in vitro maturation of embryonic stem cells. We propose that the nuclear organization of mammalian cells displays considerable plasticity to potentially throw new light on development, cancer epigenetics and evolution of imprinting. Keywords: Chromosome conformation capture, CTCF, ICR(Imprinting Control Region) 4C Assay on MBoI, MSeI, PM-Liv and MM-Liv
2012-03-27 | E-GEOD-23788 | biostudies-arrayexpress
Project description:Our goal is to identify high-confidence candidate genes associated with sub-threshold QT interval loci. We predicted enhancer-promoter targets using two different methods. 1) We used the correlation in activity between enhancers and transcribed genes across 59 human cell lines and tissues to identify significantly correlated enhancer-promoter pairs that represent potential regulatory interactions. 2) We used chromosome conformation capture followed by high-throughput sequencing (4C-seq) to probe physical enhancer-promoter interactions.
2014-10-10 | E-GEOD-53567 | biostudies-arrayexpress
Project description:We report the application of 4C-Seq technique for exploring POU5F1 enhancer interactome in mouse embryonic stem cells. A statistical model was built to identify enriched interacting regions from raw 4C data. The biological replicate data were compared to identify reproducible interacting regions. The interacting sites in the reproducible regions are enriched with active histone marks as well as transcription factors Oct4, Klf4, Esrrb, Tcfcp2i1 and Zfx that are critical for reprogramming and pluripotency. Generation of Illumina HiSeq2000 sequencing data using 4C-Seq protocol
2013-04-28 | E-GEOD-43776 | biostudies-arrayexpress
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress