Effects of hemocyte ablation on fat body gene expression
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
PROVIDER: GSE116156 | GEO | 2020/04/10
REPOSITORIES: GEO
Similar Datasets
Project description:Microglial activation represents a hallmark of inflammatory retinal diseases like diabetic retinopathy. Anti-inflammatory and especially microglia modulating approaches have been proposed as therapies for these diseases. In this study, clodronate-coated liposomes were intravitreally injected to investigate the effects of increased microglial activation on vasoregression in a model of retinal degeneration. Clodronate-coated liposomes, injected twice over a period of 5 weeks to study the effects of long term clodronate treatment on microglial activation, vasoregression (acellular capillary formation and pericyte loss) and to identify the pathways mediating the observed effects.
2021-01-29 | GSE165743 | GEO
Project description:The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus), exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery. Total small RNAs (miRNAs, siRNAs, piRNAs, etc.) were isolated and sequenced from the heads of sensor strain Aedes aegypti mosquitoes, or from the whole bodies of CHIKV-infected Aedes albopictus mosquitoes 8 hours post infection. Mosquitoes were grown at 18C or 28C in replicates of 1 (Ae. aegypti) or 3 (Ae. albopictus).
2013-08-13 | E-GEOD-46204 | biostudies-arrayexpress
Project description:<p>Description:<br/> Experimental exposure to malaria parasites can lead to development of protective immunity, providing a foothold for the development of a malaria vaccine. The goal of this study is to investigate immune transcriptional profiles associated with malaria protective immune responses induced by experimental Chemo-Prophylaxis and Sporozoites (CPS) immunization of P. <i>falciparum</i>-naive human volunteers. Samples for this study were obtained from a CPS-immunization study conducted in 2011 (ClinicalTrials.gov Identifier: NCT01218893), where healthy volunteers received CPS-immunization with bites from different numbers of P. <i>falciparum</i>-infected mosquitoes (three times 15 (n=5), 10 (n=9) or 5 (n=10)). Five control subjects received uninfected mosquito bites under chloroquine prophylaxis. Fifteen weeks after discontinuation of chloroquine prophylaxis, all volunteers were challenged by exposure to infected mosquito bites. </p> <p>Study Design:<br/> A maximum of 30 volunteers were divided into four groups. All volunteers received weekly chloroquine prophylaxis for a period of 13 weeks (91 days). During these 13 weeks, on days 8, 36 and 64 they were exposed to the bites of 15 mosquitoes. Group 1 (n=5, positive control) received three CPS immunizations by 15 mosquitoes infected with P. falciparum sporozoites. Group 2 (n=10) received three times 10 bites from infected mosquitoes and 5 bites from uninfected mosquitoes. Group 3 (n=10) received three times 5 bites from infected mosquitoes and 10 bites from uninfected mosquitoes. Group 4 (n=5), the negative control, received three placebo immunizations with 15 bites of uninfected mosquitoes. Fifteen weeks after discontinuation of chloroquine prophylaxis, all 30 volunteers were challenged at day 196 by the bites of 5 infectious mosquitoes and followed for 21 days. All subjects were treated with chloroquine 21 days after challenge or whenever they had a positive thick smear during that period. </p>
| phs001346 | dbGaP
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:Background: The mosquito Anopheles gambiae is a major vector of human malaria. Increasing evidence indicates that blood cells (hemocytes) comprise an essential arm of the mosquito innate immune response against both bacteria and malaria parasites. To further characterize the role of hemocytes in mosquito immunity, we undertook the first genome-wide transcriptomic analyses of adult female An. gambiae hemocytes following infection by two species of bacteria and a malaria parasite. Results: We identified 4047 genes expressed in hemocytes, using An. gambiae genome-wide microarrays. While 279 transcripts were significantly enriched in hemocytes relative to whole adult female mosquitoes, 959 transcripts exhibited immune challenge-related regulation. The global transcriptomic responses of hemocytes to challenge with different species of bacteria and/or different stages of malaria parasite infection revealed discrete, minimally overlapping, pathogen-specific signatures of infection-responsive gene expression; 105 of these represented putative immunity-related genes including anti-Plasmodium factors. Of particular interest was the specific co-regulation of various members of the Imd and JNK immune signaling pathways during malaria parasite invasion of the mosquito midgut epithelium. Conclusion: Our genome-wide transcriptomic analysis of adult mosquito hemocytes reveals pathogen-specific signatures of gene regulation and identifies several novel candidate genes for future functional studies. In order to identify hemocyte-specific and immune-responsive transcripts, we first compared transcripts expressed in hemocytes from one day old sugar-fed mosquitoes to transcripts detected in whole mosquitoes of the same age and feeding status. This resulted in identification of the hemocyte-enriched transcriptome. We then compared hemocytes from 1 day old mosquitoes, 1 hour after immune challenge with heat-killed Escherichia coli or Micrococcus luteus, to control female mosquitoes injected with sterile PBS to determine the bacteria challenge responsive transcriptomes. We used heat-killed bacteria in these assays, because our primary interest was in identifying the bacterial responsive transcriptome and to avoid the potentially confounding effects of altered gene expression due to the lethal effects of a systemic infection associated with injection of living bacteria. Lastly, we compared hemocytes from mosquitoes at 24 hours and 19 days after ingestion of a blood meal infected with Plasmodium berghei to mosquitoes of the same age fed a non-infected blood meal to determine the ookinete and sporozoite infection responsive transcriptomes, respectively. This design resulted in a total of five experimental treatments. The following samples are not included in this submission: Hemo E coli vs. hemo unchallenged A Hemo E coli vs. hemo unchallenged B Hemo m luteus vs. hemo unchallenged A Hemo m luteus vs. hemo unchallenged B
2011-10-31 | E-GEOD-33269 | biostudies-arrayexpress
Project description:We generated RNAseq results from the mammary tissues of mice from a 2 x 2 factorial design experiment (running wheels vs. control condition X clodronate liposomes vs. PBS liposomes) where EO771 mammary cancer cells had been engrafted in the mammary tissue for nascent tumor formation. RNAseq results were used to complete digital cytometry with the CIBERSORTx platform to analyze relative proportions of M1-like and M2-like macrophages in the mammary tissue.
2020-05-15 | GSE150620 | GEO
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress
Project description:Mononuclear phagocytes are key regulators of both tissue damage and repair in neuroinflammatory conditions such as multiple sclerosis (MS). To examine divergent phagocyte phenotypes in the inflamed central nervous system (CNS) we introduce an in vivo imaging approach combined with RNAseq and proteomics that allows us to temporally and spatially resolve the evolution of phagocyte polarization in a murine MS model. We show that the initial pro-inflammatory polarization of phagocytes is established after spinal cord entry and critically depends on the compartment they enter. Guided by signals from the CNS environment individual phagocytes then switch their phenotype as lesions move from expansion to resolution. Our study thus provides a first real-time analysis of the temporo-spatial determinants and regulatory principles of phagocyte specification in the inflamed CNS.
2019-07-10 | PXD010245 | Pride
Project description:Mosquito-borne flaviviruses maintain life cycles in mammals and mosquitoes. RNA interference (RNAi) has been demonstrated as an anti-flavivirus mechanism in mosquitoes; however, whether and how flavivirus induces and antagonizes RNAi-mediated antiviral immunity in mammals remains unknown. Here we showed that NS2A of Dengue virus-2 (DENV2) act as a viral suppressor of RNAi (VSR). When NS2A-mediated RNAi suppression was disabled, the resulting mutant DENV2 induced Dicer-dependent production of abundant DENV2-derived siRNAs in differentiated mammalian cells. Importantly, VSR-disabled DENV2 showed severe replication defects in mosquito and mammalian cells, and mice, which were rescued by the deficiency of RNAi. Moreover, NS2As of multiple flaviviruses act as VSRs in vitro and during viral infection in both organisms. Overall, our findings demonstrate that antiviral RNAi can be induced by flavivirus, while flavivirus uses NS2A as bona fide VSR to evade RNAi in mammals and mosquitoes, highlighting the importance of RNAi in flaviviral vector-host life cycles.
2020-02-24 | GSE133284 | GEO
Project description:Use of the bacterium Wolbachia is an innovative new strategy designed to break the cycle of dengue transmission. There are two main mechanisms by which Wolbachia could achieve this: by reducing the level of dengue virus in the mosquito and/or by shortening the host mosquito's lifespan. However, although Wolbachia shortens the lifespan, it also gives a breeding advantage which results in complex population dynamics. This study focuses on the development of a mathematical model to quantify the effect on human dengue cases of introducing Wolbachia into the mosquito population. The model consists of a compartment-based system of first-order differential equations; seasonal forcing in the mosquito population is introduced through the adult mosquito death rate. The analysis focuses on a single dengue outbreak typical of a region with a strong seasonally-varying mosquito population. We found that a significant reduction in human dengue cases can be obtained provided that Wolbachia-carrying mosquitoes persist when competing with mosquitoes without Wolbachia. Furthermore, using the Wolbachia strain WMel reduces the mosquito lifespan by at most 10% and allows them to persist in competition with non-Wolbachia-carrying mosquitoes. Mosquitoes carrying the WMelPop strain, however, are not likely to persist as it reduces the mosquito lifespan by up to 50%. When all other effects of Wolbachia on the mosquito physiology are ignored, cytoplasmic incompatibility alone results in a reduction in the number of human dengue cases. A sensitivity analysis of the parameters in the model shows that the transmission probability, the biting rate and the average adult mosquito death rate are the most important parameters for the outcome of the cumulative proportion of human individuals infected with dengue.
2020-03-20 | MODEL2003160002 | BioModels