Highly efficacious antiviral protection of plants by siRNAs identified in vitro
Ontology highlight
ABSTRACT:
ORGANISM(S): Nicotiana tabacum
PROVIDER: GSE121644 | GEO | 2019/10/01
REPOSITORIES: GEO
Similar Datasets
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro.
2015-04-06 | GSE64911 | GEO
Project description:Background: RNA silencing pathways play critical roles in gene regulation, virus infection, and transposon control. RNA interference (RNAi) is mediated by small interfering RNAs (siRNAs), which are liberated from double stranded (ds) RNA precursors by Dicer and direct the RNA-induced silencing complex (RISC) to target transcripts. Recent efforts have uncovered important principles governing small RNA (smRNA) sorting into RISC, yet mechanisms defining substrate selection by Dicer proteins remain uncharacterized. Methodology: To better characterize Dicer-2 substrates in Drosophila, we examined the antiviral RNAi response, which generates virus-derived siRNAs from viral RNA. Using high-throughput sequencing, we found that diverse viruses were uniquely targeted; substrates included dsRNA replication intermediates and intramolecular RNA stem loops. smRNA distribution patterns from viral and synthetic dsRNA precursors were highly reproducible, and machine learning techniques identified characteristics of precursor molecules and smRNA duplexes important in determining relative smRNA abundance. Significance: To our knowledge, this study provides the first description of the rules governing Dicer-2 substrate selection, which has important implications for exogenous RNA silencing technologies and the development of smRNA-based antiviral therapeutics. virus-derived siRNA (vsiRNA) expression comparison between control and 4 different virus-infected cells in control as well as 5 different RNAi pathway protein knock-downs in Drosophila dl1 cells
2013-01-31 | E-GEOD-28957 | biostudies-arrayexpress
Project description:Background: RNA silencing pathways play critical roles in gene regulation, virus infection, and transposon control. RNA interference (RNAi) is mediated by small interfering RNAs (siRNAs), which are liberated from double stranded (ds) RNA precursors by Dicer and direct the RNA-induced silencing complex (RISC) to target transcripts. Recent efforts have uncovered important principles governing small RNA (smRNA) sorting into RISC, yet mechanisms defining substrate selection by Dicer proteins remain uncharacterized. Methodology: To better characterize Dicer-2 substrates in Drosophila, we examined the antiviral RNAi response, which generates virus-derived siRNAs from viral RNA. Using high-throughput sequencing, we found that diverse viruses were uniquely targeted; substrates included dsRNA replication intermediates and intramolecular RNA stem loops. smRNA distribution patterns from viral and synthetic dsRNA precursors were highly reproducible, and machine learning techniques identified characteristics of precursor molecules and smRNA duplexes important in determining relative smRNA abundance. Significance: To our knowledge, this study provides the first description of the rules governing Dicer-2 substrate selection, which has important implications for exogenous RNA silencing technologies and the development of smRNA-based antiviral therapeutics.
2013-01-31 | GSE28957 | GEO
Project description:Small RNAs regulate the genetic networks through a ribonucleoprotein complex called the RNA induced silencing complexes (RISC), which in mammals contains at its center one of four Argonaute proteins (Ago1-4). A key regulatory event in the RNAi and miRNA pathways is Ago loading, where double stranded small RNA duplexes are incorporated into RISC (pre-RISC) and then become single stranded (mature-RISC), a process that is not well understood. The Agos contain an evolutionary conserved PAZ (Piwi/Argonaute/Zwille) domain whose primary function is to bind the 3’-end of small RNAs. We created multiple Paz domain disrupted Ago mutant proteins and studied their biochemical properties and biological functionality in cells. We found that the Paz domain is dispensable for Ago loading of slicing-competent RISC. In contrast, in the absence of slicer activity or slicer substrate duplex RNAs, Paz-disrupted Agos bound duplex siRNAs but were unable to unwind/eject the passenger strand and form functional RISC complexes. We have discovered that the highly conserved Paz domain plays an important role in RISC activation, providing new mechanistic insights into how miRNAs regulate genes, as well as new insights for future design of miRNA and RNAi-based therapeutics.
2012-07-12 | GSE39146 | GEO
Project description:Small RNAs regulate the genetic networks through a ribonucleoprotein complex called the RNA induced silencing complexes (RISC), which in mammals contains at its center one of four Argonaute proteins (Ago1-4). A key regulatory event in the RNAi and miRNA pathways is Ago loading, where double stranded small RNA duplexes are incorporated into RISC (pre-RISC) and then become single stranded (mature-RISC), a process that is not well understood. The Agos contain an evolutionary conserved PAZ (Piwi/Argonaute/Zwille) domain whose primary function is to bind the 3’-end of small RNAs. We created multiple Paz domain disrupted Ago mutant proteins and studied their biochemical properties and biological functionality in cells. We found that the Paz domain is dispensable for Ago loading of slicing-competent RISC. In contrast, in the absence of slicer activity or slicer substrate duplex RNAs, Paz-disrupted Agos bound duplex siRNAs but were unable to unwind/eject the passenger strand and form functional RISC complexes. We have discovered that the highly conserved Paz domain plays an important role in RISC activation, providing new mechanistic insights into how miRNAs regulate genes, as well as new insights for future design of miRNA and RNAi-based therapeutics. Various Argonautes associated small RNA profiles were generated by deep sequencing the Agos-IP samples in HEK293 Cells transfected with corresponding Argonaute.
2012-07-12 | E-GEOD-39146 | biostudies-arrayexpress
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:Plants and invertebrates protect themselves from viruses through RNA interference (RNAi), yet it remains unknown whether this defense mechanism exists in mammals. Antiviral RNAi involves the processing of viral long double-stranded (ds) RNA molecules into small interfering RNAs (siRNAs) by the ribonuclease (RNAse) III Dicer. These siRNAs are incorporated into effector complex(es) containing members of the Argonaute (Ago) protein family and guide silencing of complementary target viral RNAs. Here, we detect the accumulation of phased Dicer-dependent virus-derived siRNA (viRNAs) and demonstrate their loading into Ago2 after infection of mouse embryonic stem (ES) cells with Encephalomyocarditis virus (EMCV). We further show that the production of these viRNAs is drastically reduced, yet not completely abolished, if ES cells are first induced to differentiate before infection. Finally, we reveal that the mammalian virus Nodamura virus (NoV) encodes for a protein that counteracts such antiviral RNAi in ES cells supporting the existence of an effective RNAi-based immunity in mammals. Infection of wild-type or mutant mouse ES cells and analysis of small RNAs from total extracts or immunoprecipitated components of the RNAi pathway
2013-10-10 | E-GEOD-43153 | biostudies-arrayexpress
Project description:RNA interference (RNAi) functions as a potent antiviral immunity in plants and invertebrates, however whether RNAi plays antiviral roles in mammals remains unclear. Here, using human enterovirus 71 (HEV71) as a model, we showed HEV71 3A protein as an authentic viral suppressor of RNAi during viral infection. When the 3A-mediated RNAi suppression was impaired, the mutant HEV71 readily triggered the production of abundant HEV71-derived small RNAs with canonical siRNA properties in cells and mice. These virus-derived siRNAs were produced from viral dsRNA replicative intermediates in a Dicer-dependent manner, loaded into AGO, and were fully active in degrading cognate viral RNAs. Recombinant HEV71 deficient in 3A-mediated RNAi suppression was significantly restricted in human somatic cells and mice, whereas Dicer-deficiency rescued HEV71 infection independently of type I interferon response. Thus, RNAi can function as an antiviral immunity, which is induced and suppressed by a human virus, in mammals.
2017-08-01 | GSE99252 | GEO
Project description:One goal of viral infection is to reprogram the host cell to optimize viral replication. As part of this process, viral miRNAs may compete for components of the miRNA/siRNA pathway as well as regulate cellular targets. Mouse Cytomegalovirus has been described to generate large numbers of viral miRNAs during lytic infection and was therefore used to analyze the impact of viral miRNAs on the host cell small RNA system as well as to check for sorting of viral small RNAs into specific Ago-proteins. Deep sequencing analysis of MCMV infected cells revealed that viral miRNAs represent only app. 13% of all detected miRNAs. All previously described MCMV miRNAs with the exception of miR-m88-1* were confirmed and for the MCMV miR-m01-1 hairpin an additional miRNA, designated miR-m01-1-3p, was found. Its presence was confirmed by qPCR and Northern Blot. Deep sequencing after RISC IP with antibodies specific for either Ago1 or Ago2 showed that all MCMV miRNAs are loaded into both RISC complexes. The ratio of MCMV to mouse miRNAs was not increased after immunoprecipitation of Ago-proteins. Viral miRNAs therefore do not overwhelm the host miRNA processing system nor are they preferentially incorporated into RISC. We found that 3 mouse miRNAs showed an altered expression due to MCMV infection. Down-regulation of miR-27a, as previously described, could be confirmed. In addition, miR-26a was down-regulated and an up-regulation of miR-7a dependent on viral protein expression could be observed. Examination of small RNA expression in uninfected vs. infected cells, immunoprecipitation + sequencing of Ago1 and Ago2 loaded small RNAs in infected cells
2012-06-30 | E-GEOD-36919 | biostudies-arrayexpress
Project description:Plants and invertebrates protect themselves from viruses through RNA interference (RNAi), yet it remains unknown whether this defense mechanism exists in mammals. Antiviral RNAi involves the processing of viral long double-stranded (ds) RNA molecules into small interfering RNAs (siRNAs) by the ribonuclease (RNAse) III Dicer. These siRNAs are incorporated into effector complex(es) containing members of the Argonaute (Ago) protein family and guide silencing of complementary target viral RNAs. Here, we detect the accumulation of phased Dicer-dependent virus-derived siRNA (viRNAs) and demonstrate their loading into Ago2 after infection of mouse embryonic stem (ES) cells with Encephalomyocarditis virus (EMCV). We further show that the production of these viRNAs is drastically reduced, yet not completely abolished, if ES cells are first induced to differentiate before infection. Finally, we reveal that the mammalian virus Nodamura virus (NoV) encodes for a protein that counteracts such antiviral RNAi in ES cells supporting the existence of an effective RNAi-based immunity in mammals.
2013-10-10 | GSE43153 | GEO